DRAMP_ID Sequence Hiden_Sequence Original_Sequence Sequence_Length Name Uniprot_Entry Family Source Activity Protein_Existence Secondary_Structure Structure_Description PDB_ID Comments Target_Organism Hemolytic_Activity Linear/Cyclic N_terminal_Modification C_terminal_Modification Special_Amino_Acid_and_Stapling_Position Stereochemistry Cytotoxicity Pubmed_ID Reference Author Title Specific_Type Nucleotide_Sequence Full_Sequence lfcMLE padj Workflow DRAMP21651 TLDPPYFLDPVSPNPMCHRP 20 SLAY-screened peptide P1 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTCTTGACCCTCCCTATTTTCTCGATCCTGTCAGCCCCAATCCCATGTGCCACCGTCCCTAA TLDPPYFLDPVSPNPMCHRP* -11.199 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21652 LQSPDLQHFQYLLLLSGSRGL 21 SLAY-screened peptide P2 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTCAGAGCCCTGACTTACAGCATTTTCAATACTTATTACTGTTATCAGGGTCCCGGGGTCTA LQSPDLQHFQYLLLLSGSRGL -11.079 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21653 QRRH 4 SLAY-screened peptide P3 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGCGCCGGCATTAGCTGCACACGAGTTCGCTGTCCCCCAGTCTGGGCAGTTTTTGGGCTTAA QRRH*LHTSSLSPSLGSFWA* -10.843 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21654 AGAAFNSCAR 10 SLAY-screened peptide P4 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCGGGGCGGCTTTCAATTCCTGTGCCAGGTAGGATGACAACTTCTACATCTATTATGCGTAA AGAAFNSCAR*DDNFYIYYA* -10.83 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21655 SSHLPHHGCNRRFVDGPAPPQ 21 SLAY-screened peptide P5 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTTCGCACCTTCCCCATCACGGTTGTAACCGCCGTTTTGTGGACGGCCCCGCCCCCCCCCAA SSHLPHHGCNRRFVDGPAPPQ -10.803 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21656 NATMLCLSDNFCNENFTHQA 20 SLAY-screened peptide P6 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATGCTACTATGCTCTGCCTTTCCGATAATTTTTGCAACGAGAATTTTACGCATCAGGCCTAA NATMLCLSDNFCNENFTHQA* -10.8 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21657 GDS 3 SLAY-screened peptide P7 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGCGATAGCTAGTGTTTCAAGTATACTTATCCCTGGAATAATGACTACCACGTTAGCGCGTAA GDS*CFKYTYPWNNDYHVSA* -10.604 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21658 IHPLSFR 7 SLAY-screened peptide P8 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATCCATCCCCTCTCCTTTCGTTAGTATCGCAACGTTCGGACCATTAATTCGTCCGCTGTGTAA IHPLSFR*YRNVRTINSSAV* -10.57 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21659 WYVFSLAVAPVNNTNRDGSP 20 SLAY-screened peptide P9 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGGTACGTCTTCAGTCTCGCCGTCGCGCCTGTTAACAATACGAATCGCGATGGGTCCCCTTAA WYVFSLAVAPVNNTNRDGSP* -10.462 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21660 PSNAVMPINARYKSGYSPAS 20 SLAY-screened peptide P10 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTAGCAATGCTGTTATGCCCATTAATGCCCGCTACAAGAGCGGTTATTCGCCTGCCTCTTAA PSNAVMPINARYKSGYSPAS* -10.364 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21661 NNLYHTHGNCYKDTNINFEN 20 SLAY-screened peptide P11 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATAATCTCTACCACACTCATGGGAATTGCTACAAGGACACCAATATTAATTTTGAGAACTAA NNLYHTHGNCYKDTNINFEN* -10.274 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21662 HLLPVISI 8 SLAY-screened peptide P12 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATCTGCTCCCCGTCATCTCTATCTAGCATCAGGTCGTCTCCGTGGGTCATGACGCGCTGTAA HLLPVISI*HQVVSVGHDAL* -10.157 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21663 LTASRAPGSLPTVWLPIVLLN 21 SLAY-screened peptide P13 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTACTGCGTCTCGAGCACCGGGGTCATTACCAACTGTTTGGCTCCCTATAGTACTACTTAAC LTASRAPGSLPTVWLPIVLLN -10.141 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21664 IG 2 SLAY-screened peptide P14 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTGGTTAGGGTGACCTTTACATCACTGAGACTTAGGATTATAATAGTAGTCTTTTTGATTAA IG*GDLYITET*DYNSSLFD* -10.056 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21665 APMGYSSVASSMSTSSYFID 20 SLAY-screened peptide P15 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCCCCATGGGTTATTCTTCTGTCGCGTCTAGCATGTCTACTTCTTCTTACTTTATTGACTAA APMGYSSVASSMSTSSYFID* -10.041 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21666 RPRLSGIMTYYVSTWISYIC 20 SLAY-screened peptide P16 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCCCCCGTCTTAGCGGGATCATGACCTATTACGTTTCCACTTGGATCAGCTACATTTGTTAA RPRLSGIMTYYVSTWISYIC* -10.03 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21667 LSGERRHTVGVQTMHSDHME 20 SLAY-screened peptide P17 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTTCTGGTGAGAGGAGGCACACTGTCGGTGTCCAGACCATGCATTCTGATCATATGGAGTAA LSGERRHTVGVQTMHSDHME* -9.883 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21668 QSKPDATQPYVHYCKRRLLR 20 SLAY-screened peptide P18 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGTCCAAGCCTGACGCTACTCAGCCTTATGTCCATTACTGCAAGCGTCGTCTCCTGCGTTAA QSKPDATQPYVHYCKRRLLR* -9.861 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21669 PCATALIPSPRQDSRTL 17 SLAY-screened peptide P19 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGTGCGCTACGGCCCTCATTCCTTCGCCTCGGCAGGATTCCCGGACCCTGTAGATTAAGTAA PCATALIPSPRQDSRTL*IK* -9.719 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21670 GCLNFSVPVDRPVSPAKTAW 20 SLAY-screened peptide P20 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGTTGTCTGAACTTTTCTGTCCCCGTGGACCGGCCTGTGTCGCCTGCCAAGACGGCCTGGTAA GCLNFSVPVDRPVSPAKTAW* -9.619 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21671 RVVILMLS 8 SLAY-screened peptide P21 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCGTCGTCATCTTGATGTTGTCCTAGAATGCTTGTCATCAGTTGCATCTGACGATTTCTTAA RVVILMLS*NACHQLHLTIS* -9.558 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21672 FRCPPFKFSCLALAFTDYNN 20 SLAY-screened peptide P22 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTTCGGTGCCCGCCGTTTAAGTTCTCCTGTCTTGCCCTTGCTTTTACGGATTATAACAATTAA FRCPPFKFSCLALAFTDYNN* -9.504 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21673 PVRCVTPTSPCAPNPHYHDQ 20 SLAY-screened peptide P23 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGGTGCGTTGTGTCACGCCTACTTCTCCGTGTGCTCCTAATCCTCACTACCATGATCAGTAA PVRCVTPTSPCAPNPHYHDQ* -9.45 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21674 YAFFINNDCFYYCSLGPCASN 21 SLAY-screened peptide P24 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATACGCCTTTTTTATCAATAATGATTGTTTTTATTATTGTTCTTTAGGCCCATGTGCATCTAAC YAFFINNDCFYYCSLGPCASN -9.396 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21675 PLAPIVQTYS 10 SLAY-screened peptide P25 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGCTTGCCCCGATTGTTCAGACGTACTCTTAGAGCACTAATCTGTATCGCGGTTATTGCTAA PLAPIVQTYS*STNLYRGYC* -9.352 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21676 SWHWLSSNHIATVSVETYSH 20 SLAY-screened peptide P26 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGCTGGCACTGGCTTTCTTCTAATCATATCGCGACCGTGAGCGTTGAGACCTACTCCCACTAA SWHWLSSNHIATVSVETYSH* -9.321 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21677 TLSVFFCIHPPPCSVSTSPY 20 SLAY-screened peptide P27 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTCTCTCCGTCTTTTTCTGCATCCACCCCCCCCCCTGTAGTGTCTCTACGTCTCCGTATTAA TLSVFFCIHPPPCSVSTSPY* -9.161 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21678 YLLARLALQTFFSHGFYTFP 20 SLAY-screened peptide P28 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATACCTGCTCGCTCGGCTCGCCCTGCAGACGTTTTTCAGTCACGGTTTCTATACTTTTCCTTAA YLLARLALQTFFSHGFYTFP* -9.158 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21679 LTLLICPDDTFYKAK 15 SLAY-screened peptide P29 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTACCTTGCTTATTTGCCCCGATGATACTTTTTATAAGGCGAAGTAGGCCTCTCCTTTTTAA LTLLICPDDTFYKAK*ASPF* -9.154 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21680 NLFPSHSATFRH 12 SLAY-screened peptide P30 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATTTGTTCCCGAGCCATTCTGCCACCTTTCGGCATTAGGATTATATTCTGCGTTTTCGTTAA NLFPSHSATFRH*DYILRFR* -9.146 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21681 TSDYILVQFYFS 12 SLAY-screened peptide P31 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCTCTGATTACATTTTGGTTCAGTTTTATTTTTCTTAGACGCTCACCCACCTCAACTGTTAA TSDYILVQFYFS*TLTHLNC* -9.104 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21682 PCISQSNDVCPSRESLPLCI 20 SLAY-screened peptide P32 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTTGTATCAGCCAGTCGAACGACGTCTGCCCGTCGCGTGAGTCTTTGCCTCTGTGTATTTAA PCISQSNDVCPSRESLPLCI* -9.092 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21683 GHAHPCTNFIYDINLNPPPPP 21 SLAY-screened peptide P33 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGGCACGCCCACCCTTGCACGAACTTTATCTACGACATTAACCTGAACCCCCCCCCCCCCCCC GHAHPCTNFIYDINLNPPPPP -8.993 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21684 YASHCPCRTICYHVSP 16 SLAY-screened peptide P34 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATACGCCTCCCACTGCCCCTGTCGCACCATTTGTTATCACGTTTCGCCGTAGTACTCCAGGTAA YASHCPCRTICYHVSP*YSR* -8.968 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21685 SKCSITTRRQYAHPRSAV 18 SLAY-screened peptide P35 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCAAGTGCAGTATCACTACCAGGAGGCAGTACGCGCACCCTCGTAGTGCGGTTTAGAATTAA SKCSITTRRQYAHPRSAV*N* -8.946 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21686 TREATPCARIRSDSFGTT 18 SLAY-screened peptide P36 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGCGTGAGGCGACTCCCTGCGCGCGTATTCGCTCCGACTCTTTTGGGACGACCTAGCCCTAA TREATPCARIRSDSFGTT*P* -8.937 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21687 TPMDRSLCHNHTL 13 SLAY-screened peptide P37 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCCCTATGGATCGTAGCCTCTGTCATAACCATACGCTTTAGATGGCGCAGGATAGTCATTAA TPMDRSLCHNHTL*MAQDSH* -8.916 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21688 SVRSSAPLMRVIGNCPSNHH 20 SLAY-screened peptide P38 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTGTGCGTTCTAGCGCGCCTCTTATGCGTGTGATCGGCAATTGCCCGAGTAATCACCACTAA SVRSSAPLMRVIGNCPSNHH* -8.863 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21689 LLYEVDPAT 9 SLAY-screened peptide P39 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGCTTTACGAGGTCGACCCTGCCACTTAGTTCCATTCCCCCCCCCCCGCCCCCCCCCCCCCT LLYEVDPAT*FHSPPPAPPPP -8.836 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21690 SGSSPRNTQTP 11 SLAY-screened peptide P40 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCGGGGTCGTCGCCGCGGAATACGCAGACGCCCTAGGATTATTGCACTATGGTTCACACGTAA SGSSPRNTQTP*DYCTMVHT* -8.805 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21691 ANPAYKFKTCILCL 14 SLAY-screened peptide P41 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCAATCCTGCTTATAAGTTTAAAACATGTATACTATGTCTGTGAGGGGGTTCGACAACTAAC ANPAYKFKTCILCL*GGSTTN -8.804 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21692 HTSNEDKTVYPVHSECIFDY 20 SLAY-screened peptide P42 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATACCAGTAATGAGGATAAGACCGTGTATCCGGTTCACTCTGAGTGTATTTTTGACTATTAA HTSNEDKTVYPVHSECIFDY* -8.804 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21693 LYAEVGRLLIDLGAT 15 SLAY-screened peptide P43 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTTACGCGGAGGTGGGGCGTCTCCTGATCGACCTTGGGGCCACCTAACTGAGTAAGTCGACC LYAEVGRLLIDLGAT*LSKST -8.765 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21694 RLDLASPFDIGIEGLSPANL 20 SLAY-screened peptide P44 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCCTCGATCTCGCTTCGCCTTTTGATATTGGTATTGAGGGTCTCTCCCCGGCTAACCTTTAA RLDLASPFDIGIEGLSPANL* -8.762 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21695 FYVPLRSSQPQPPISCRHTP 20 SLAY-screened peptide P45 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTCTACGTTCCCCTCCGGAGCTCCCAGCCTCAGCCCCCCATTTCCTGCCGCCACACCCCCTAA FYVPLRSSQPQPPISCRHTP* -8.749 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21696 LLVSSPSMRPIAVTPSGPAPN 21 SLAY-screened peptide P46 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGCTCGTCAGTTCTCCCTCCATGCGCCCGATAGCAGTAACCCCCTCGGGTCCTGCCCCTAAC LLVSSPSMRPIAVTPSGPAPN -8.745 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21697 THHMTGGVSWRGAPSLPYVN 20 SLAY-screened peptide P47 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTCACCACATGACCGGCGGTGTCAGTTGGAGGGGGGCCCCCAGCCTCCCTTATGTCAATTAA THHMTGGVSWRGAPSLPYVN* -8.737 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21698 THHMTGGVSWRGAPSLPYVN 20 SLAY-screened peptide P48 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTCATCACATGACCGGCGGTGTCAGTTGGAGGGGGGCCCCCAGCCTCCCTTATGTCAATTAA THHMTGGVSWRGAPSLPYVN* -8.737 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21699 AYRRLPLHARSPTVRVNLET 20 SLAY-screened peptide P49 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCTACCGCCGTTTGCCCCTTCATGCTCGTTCTCCCACTGTTCGCGTTAATCTGGAGACGTAA AYRRLPLHARSPTVRVNLET* -8.731 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21700 SPDFLRCSHTSRFVAYLLLS 20 SLAY-screened peptide P50 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCCCGGATTTCCTGCGGTGCAGTCATACGTCTCGCTTTGTCGCCTATTTGTTGCTCTCGTAA SPDFLRCSHTSRFVAYLLLS* -8.723 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21701 EYPCILTQTAVNNSNSDTVY 20 SLAY-screened peptide P51 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGAGTACCCCTGCATTCTGACCCAGACTGCTGTTAACAACTCGAATTCCGATACGGTGTATTAA EYPCILTQTAVNNSNSDTVY* -8.716 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21702 RPSIAPRFSPIGSDNMLISF 20 SLAY-screened peptide P52 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGGCCGTCTATTGCCCCTCGTTTTAGTCCTATCGGTAGTGACAATATGCTCATTTCTTTTTAA RPSIAPRFSPIGSDNMLISF* -8.714 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21703 CTGYHKLNARDTVNSDISSS 20 SLAY-screened peptide P53 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGTACCGGCTACCATAAGCTTAATGCCAGGGACACTGTTAATTCCGATATTTCGTCCAGTTAA CTGYHKLNARDTVNSDISSS* -8.684 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21704 IRVSNQSGLYGCPITLDWRL 20 SLAY-screened peptide P54 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTCGTGTTTCTAATCAGTCCGGCCTTTACGGTTGTCCTATCACTCTCGATTGGCGCCTGTAA IRVSNQSGLYGCPITLDWRL* -8.667 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21705 DYRCGTRRFTIWAHLLGI 18 SLAY-screened peptide P55 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATTACCGTTGTGGTACTCGTCGGTTTACGATTTGGGCTCATCTCTTGGGCATTTAGGTTTAA DYRCGTRRFTIWAHLLGI*V* -8.653 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21706 TGADGAHSCLITHYTENYGN 20 SLAY-screened peptide P56 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCGGGGCGGACGGCGCTCACAGCTGCTTGATTACGCACTATACTGAGAATTATGGCAATTAA TGADGAHSCLITHYTENYGN* -8.641 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21707 IVLGAIHHYSSPSALSRVLQ 20 SLAY-screened peptide P57 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTGTCCTTGGCGCGATTCATCATTATTCTTCTCCTTCTGCTCTGTCTCGCGTCCTCCAGTAA IVLGAIHHYSSPSALSRVLQ* -8.636 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21708 ANLLIWLGLYLSHQNRRVDD 20 SLAY-screened peptide P58 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTAACCTCCTGATTTGGCTCGGGTTGTATCTTTCCCACCAGAATAGGCGGGTCGACGATTAA ANLLIWLGLYLSHQNRRVDD* -8.62 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21709 LDPSYIFLDSSPMLRAESIN 20 SLAY-screened peptide P59 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTGGATCCTTCTTATATCTTTCTCGACTCGTCGCCGATGCTTCGGGCGGAGAGCATTAACTAA LDPSYIFLDSSPMLRAESIN* -8.59 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21710 GNHLACLGVRLIRGFNLHHL 20 SLAY-screened peptide P60 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGCAATCATCTGGCTTGCTTGGGTGTTCGCCTTATTCGTGGCTTTAACCTGCATCATTTGTAA GNHLACLGVRLIRGFNLHHL* -8.552 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21711 HGVHHLNDHLSFLTLNLSLH 20 SLAY-screened peptide P61 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATGGCGTTCATCACCTTAACGATCACTTGTCGTTTCTGACCCTTAATCTTTCCCTTCATTAA HGVHHLNDHLSFLTLNLSLH* -8.52 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21712 IRSCLRTVRLLVTTHYYHRE 20 SLAY-screened peptide P62 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATCCGTTCTTGTCTCCGTACGGTTCGTCTCCTTGTCACTACGCATTATTATCATCGCGAGTAA IRSCLRTVRLLVTTHYYHRE* -8.497 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21713 YDLDRGCAYNLLVYAERYYQ 20 SLAY-screened peptide P63 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATACGACTTGGATCGGGGTTGTGCTTATAATCTCCTTGTCTATGCGGAGCGTTACTATCAGTAA YDLDRGCAYNLLVYAERYYQ* -8.477 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21714 RNLHLTASPVRVPRHRPINS 20 SLAY-screened peptide P64 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCAACCTTCATCTCACGGCGTCCCCGGTGCGTGTCCCGAGGCATCGTCCGATCAATAGTTAA RNLHLTASPVRVPRHRPINS* -8.421 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21715 RSSFHRIIYFIENHHIKNAI 20 SLAY-screened peptide P65 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGTCTAGCTTTCATCGCATTATTTACTTCATTGAGAATCATCATATCAAGAACGCGATCTAA RSSFHRIIYFIENHHIKNAI* -8.419 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21716 QLTMNNPRMPSSA 13 SLAY-screened peptide P66 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGCTTACTATGAACAACCCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAACGCCATTTAA QLTMNNPRMPSSA*KKKNAI* -8.411 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21717 RCPHISASYVVLPGVIHSTT 20 SLAY-screened peptide P67 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCTGCCCCCACATTAGTGCCAGCTATGTTGTTCTTCCCGGTGTTATCCATTCGACGACCTAA RCPHISASYVVLPGVIHSTT* -8.4 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21718 RRVRHRILSDIRVAHYRRWP 20 SLAY-screened peptide P68 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGCGCGTCCGCCATCGTATCCTTAGTGACATCCGCGTGGCGCATTATAGGAGGTGGCCGTAA RRVRHRILSDIRVAHYRRWP* -8.381 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21719 TRTSSQTVAGNPRYNNSERS 20 SLAY-screened peptide P69 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGCGCACTTCGTCTCAGACCGTTGCTGGTAATCCCAGGTACAATAATTCTGAGCGGTCCTAA TRTSSQTVAGNPRYNNSERS* -8.38 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21720 ALAYFHRVCA 10 SLAY-screened peptide P70 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGCTGGCGTATTTCCATCGGGTTTGCGCTTAGGATCAGAGTGTCGTGTGCGTCACTTGGTAA ALAYFHRVCA*DQSVVCVTW* -8.365 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21721 SHNPHIRGPIQRSRKRPRRT 20 SLAY-screened peptide P71 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTCATAACCCTCATATTCGGGGCCCCATCCAGAGGTCTCGTAAGCGTCCTAGGAGGACCTAA SHNPHIRGPIQRSRKRPRRT* -8.345 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21722 RSPCAPYAPPPLTFFRTVSA 20 SLAY-screened peptide P72 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCAGTCCTTGCGCGCCGTACGCCCCCCCCCCTCTTACTTTCTTCCGTACCGTCAGTGCTTAA RSPCAPYAPPPLTFFRTVSA* -8.329 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21723 CTPAPPGIPCCSAYTFYYNR 20 SLAY-screened peptide P73 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGTACCCCGGCGCCCCCTGGGATTCCTTGTTGTTCGGCTTACACTTTTTATTATAATCGCTAA CTPAPPGIPCCSAYTFYYNR* -8.325 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21724 STVQYHWNNSPFDSHARRTI 20 SLAY-screened peptide P74 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTACCGTCCAGTATCATTGGAATAATAGTCCTTTTGACAGTCATGCTCGCCGGACGATCTAA STVQYHWNNSPFDSHARRTI* -8.161 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21725 LTFHCHHNNDCNFNYLSSTL 20 SLAY-screened peptide P75 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTACCTTTCATTGCCATCATAATAATGATTGTAATTTCAATTATCTGAGCAGTACTCTGTAA LTFHCHHNNDCNFNYLSSTL* -8.127 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21726 PKHSYSNVLA 10 SLAY-screened peptide P76 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTAAGCATAGTTACAGTAACGTTTTGGCTTAGTATGACAACCTGGGTTACACTAGTAATTAA PKHSYSNVLA*YDNLGYTSN* -8.121 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21727 SSNYRQSECYDTSSFTYVLI 20 SLAY-screened peptide P77 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCTCTAATTATCGCCAGTCGGAGTGTTACGATACCTCTTCCTTTACGTACGTCCTTATTTAA SSNYRQSECYDTSSFTYVLI* -8.093 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21728 IGDVMATVATLINASSLYFP 20 SLAY-screened peptide P78 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATCGGCGACGTTATGGCTACTGTTGCTACTCTTATTAATGCTTCTAGCCTTTACTTTCCTTAA IGDVMATVATLINASSLYFP* -8.09 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21729 NVILRNSGLHASICSPPPPPP 21 SLAY-screened peptide P79 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATGTCATCCTGCGCAACAGCGGGCTCCACGCTAGCATCTGTTCCCCCCCCCCCCCCCCCCCC NVILRNSGLHASICSPPPPPP -8.039 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21730 VASVFNCRNCLSYSNPNDTP 20 SLAY-screened peptide P80 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTTGCGTCTGTGTTCAATTGCCGTAATTGTCTTTCTTATTCGAATCCTAATGACACTCCTTAA VASVFNCRNCLSYSNPNDTP* -6.795 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21731 TASHSSSQYPKT 12 SLAY-screened peptide P81 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTGCGAGTCATAGTTCGTCTCAGTATCCTAAGACGTAGGTCTAGACTCTGACTATTTCTTAA TASHSSSQYPKT*V*TLTIS* -6.774 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21732 LWNWDCFCFLRYHFGKRTTN 20 SLAY-screened peptide P82 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTGTGGAACTGGGATTGTTTCTGTTTCCTTCGTTATCACTTTGGGAAGCGTACCACTAATTAA LWNWDCFCFLRYHFGKRTTN* -6.704 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21733 PLLHIFNSTAMYIY 14 SLAY-screened peptide P83 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGCTCCTGCATATTTTTAATTCTACCGCTATGTATATTTATTAGATCAACGCGCACAATTAA PLLHIFNSTAMYIY*INAHN* -6.629 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21734 PYGASTANIDFLDVFIYNTT 20 SLAY-screened peptide P84 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCTACGGGGCGAGCACTGCGAATATTGATTTTCTGGATGTGTTTATCTACAATACGACGTAA PYGASTANIDFLDVFIYNTT* -6.558 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21735 SS 2 SLAY-screened peptide P85 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTTCTTAGACTTTTGTTTCTATCTGCTCTACGATGTACTCCGACTTCTGCACTTATGCCTAA SS*TFVSICSTMYSDFCTYA* -6.536 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21736 TK 2 SLAY-screened peptide P86 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCAAGTAGCATAATAAGGCGGTCAATTATAAGCGTTCTGTGTCTATTGAGACTGATTTTTAA TK*HNKAVNYKRSVSIETDF* -6.471 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21737 STLCIQSRPSNTSCIHLAKN 20 SLAY-screened peptide P87 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCGACGCTGTGTATTCAGTCTCGTCCTTCGAATACCTCCTGTATCCACCTTGCGAAGAACTAA STLCIQSRPSNTSCIHLAKN* -6.43 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21738 TIRLHVSIRIYLWRRRMVSA 20 SLAY-screened peptide P88 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTATCCGGTTGCATGTCAGCATCCGCATTTACCTTTGGAGGCGCCGCATGGTGTCTGCGTAA TIRLHVSIRIYLWRRRMVSA* -6.219 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21739 TQLYHTWH 8 SLAY-screened peptide P89 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGCAGCTGTATCATACGTGGCACTAGACGAATAATGAGACTATTCCTAACTATAATGCGTAA TQLYHTWH*TNNETIPNYNA* -6.152 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21740 LPLKASQH 8 SLAY-screened peptide P90 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTCCGCTTAAGGCTAGCCAGCACTAGAACGTGTGTCGTACTCAGACTGGTAATAATGCTTAA LPLKASQH*NVCRTQTGNNA* -5.974 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21741 CALIIIFFYVRVCVRVSLTC 20 SLAY-screened peptide P91 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCGCTTTGATCATTATTTTTTTCTACGTTCGGGTTTGCGTGCGTGTGAGTCTGACGTGCTAA CALIIIFFYVRVCVRVSLTC* -5.958 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21742 YGRSHATPNSDVSSMSPITA 20 SLAY-screened peptide P92 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATGGTAGGTCTCATGCTACTCCTAATAGTGACGTGTCTAGCATGAGTCCGATCACTGCCTAA YGRSHATPNSDVSSMSPITA* -5.944 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21743 RLAHFPNHAVCDPHIINKPL 20 SLAY-screened peptide P93 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGCTCGCTCACTTTCCGAATCATGCTGTCTGCGATCCTCATATTATCAATAAGCCGCTTTAA RLAHFPNHAVCDPHIINKPL* -5.777 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21744 RLGHDSNPWHIFRYNNNIPI 20 SLAY-screened peptide P94 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCTTGGGTCATGATAGCAACCCTTGGCATATTTTCCGTTATAATAACAATATCCCCATTTAA RLGHDSNPWHIFRYNNNIPI* -5.759 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21745 RYHTHYC 7 SLAY-screened peptide P95 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGTTACCACACGCACTACTGCTAGGCTACGAATAATTATTTTAATGACGATTATTTTGCCTAA RYHTHYC*ATNNYFNDDYFA* -5.733 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21746 LQLSPRYVSRSYDCPTPLTT 20 SLAY-screened peptide P96 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTCAGCTTAGCCCTCGTTATGTTTCGCGCAGTTATGATTGCCCTACTCCTCTCACTACTTAA LQLSPRYVSRSYDCPTPLTT* -5.69 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21747 RRCPPSSFAGHDPHRPIY 18 SLAY-screened peptide P97 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGGCGGTGCCCTCCTTCTTCGTTTGCTGGTCATGACCCTCATAGGCCTATTTATTAGATCTAA RRCPPSSFAGHDPHRPIY*I* -5.652 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21748 SSWAGHTRCGRCHPRYCYVT 20 SLAY-screened peptide P98 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCGTCTTGGGCTGGCCATACTCGCTGTGGCCGTTGCCATCCTAGGTACTGTTATGTCACTTAA SSWAGHTRCGRCHPRYCYVT* -5.625 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21749 LYCNHHTTLRCPKITVQNTR 20 SLAY-screened peptide P99 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTGTACTGTAATCATCACACTACGCTGCGTTGTCCTAAGATTACGGTCCAGAATACCAGGTAA LYCNHHTTLRCPKITVQNTR* -5.55 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21750 GHCSQIRFTACPIHALCNGT 20 SLAY-screened peptide P100 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGGCATTGTTCTCAGATTCGTTTTACGGCTTGCCCTATCCATGCGCTGTGCAACGGTACTTAA GHCSQIRFTACPIHALCNGT* -5.494 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21751 LYMFNSTMSNVAYEFI 16 SLAY-screened peptide P101 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTGTATATGTTCAATAGTACTATGTCTAATGTCGCTTATGAGTTCATCTAGCCGAAGCCTTAA LYMFNSTMSNVAYEFI*PKP* -5.475 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21752 YVTASNLYFVNCFTMFVMAK 20 SLAY-screened peptide P102 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATGTTACTGCGTCCAATCTGTATTTTGTCAATTGCTTTACTATGTTCGTTATGGCTAAGTAA YVTASNLYFVNCFTMFVMAK* -5.442 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21753 RRDCNIESHYLRTPRS 16 SLAY-screened peptide P103 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCCGTGATTGTAATATTGAGTCTCACTATCTGCGGACGCCTCGTTCGTAACTGAGTAAGTCG RRDCNIESHYLRTPRS*LSKS -5.421 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21754 GSLTSIDRCELDHVGYIHYK 20 SLAY-screened peptide P104 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGCAGTCTTACTAGTATTGATCGGTGCGAGCTGGACCATGTTGGTTATATCCATTACAAGTAA GSLTSIDRCELDHVGYIHYK* -5.395 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21755 FVTQYSPFLGYFAPTRCSVP 20 SLAY-screened peptide P105 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTCGTCACTCAGTACAGCCCTTTTCTTGGCTATTTTGCTCCTACGCGTTGTTCCGTTCCGTAA FVTQYSPFLGYFAPTRCSVP* -5.357 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21756 IVFSGHDLQTDYLNNRIHLV 20 SLAY-screened peptide P106 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTGTGTTTTCGGGGCACGATCTGCAGACTGACTATCTTAATAACAGGATCCACCTGGTGTAA IVFSGHDLQTDYLNNRIHLV* -5.343 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21757 PSFPSIYIRLSRIRHRHRRG 20 SLAY-screened peptide P107 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCTCCTTTCCGTCTATCTACATTCGTCTCTCCCGCATCCGTCACCGGCATCGTCGTGGCTAA PSFPSIYIRLSRIRHRHRRG* -5.325 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21758 ADSQHAPP 8 SLAY-screened peptide P108 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGGACTCGCAGCACGCCCCTCCTTAGAATCACTATAAGTTTTATGATATTAGCGAGCCCTAA ADSQHAPP*NHYKFYDISEP* -5.287 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21759 YPYDRLSNVFDSLHYYCIQT 20 SLAY-screened peptide P109 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATACCCTTATGATCGCTTGTCTAACGTGTTCGATAGCCTTCATTATTATTGTATTCAGACCTAA YPYDRLSNVFDSLHYYCIQT* -5.205 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21760 PQLFTNHTPDSSYGIILAL 19 SLAY-screened peptide P110 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTCAGCTGTTTACCAATCACACTCCTGATTCTAGCTATGGCATTATTCTTGCTTTGTAGTAA PQLFTNHTPDSSYGIILAL** -5.112 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21761 ERAPSYHTRSSSDSSNSGET 20 SLAY-screened peptide P111 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGAGCGTGCTCCTAGTTATCATACTCGGAGCTCGAGTGACTCGAGCAATAGCGGTGAGACCTAA ERAPSYHTRSSSDSSNSGET* -5.096 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21762 TLVHNDSLSAQEPPPLSQ 18 SLAY-screened peptide P112 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTCTTGTGCATAATGATAGTTTGTCTGCTCAGGAGCCGCCGCCTCTGTCTCAGTAGGCTTAA TLVHNDSLSAQEPPPLSQ*A* -5.093 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21763 SHNCIHYP 8 SLAY-screened peptide P113 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTCACAATTGTATTCACTATCCTTAGATGGATTTGTAGAACATGGCTCTGAAGAATGGGTAA SHNCIHYP*MDL*NMALKNG* -5.025 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21764 CPVQQSTYDKCSQPYRDTQH 20 SLAY-screened peptide P114 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGTCCGGTTCAGCAGAGCACTTACGATAAGTGTTCTCAGCCTTACCGTGATACTCAGCATTAA CPVQQSTYDKCSQPYRDTQH* -4.993 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21765 RPYPPNFRRTPTQLPHLLVS 20 SLAY-screened peptide P115 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGTCCCTATCCGCCGAACTTCAGGCGTACTCCCACCCAGCTTCCGCATCTTCTGGTCTCTTAA RPYPPNFRRTPTQLPHLLVS* -4.902 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21766 KRELT 5 SLAY-screened peptide P116 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAAGCGCGAGTTGACTTAGATGCAGGCCCCTAAGCCTTTTATTTTTTTTGCGAATCACTGCTAA KRELT*MQAPKPFIFFANHC* -4.755 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21767 FDNTRMFCTIDIYNTDLHMH 20 SLAY-screened peptide P117 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTTGATAACACCCGTATGTTCTGTACCATTGATATCTATAACACTGATTTGCATATGCATTAA FDNTRMFCTIDIYNTDLHMH* -4.737 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21768 DDPIVFVSRTNVLPHY 16 SLAY-screened peptide P118 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGACGACCCTATTGTTTTCGTCTCTCGTACGAATGTGTTGCCGCACTATTAGCATGCGGCGTAA DDPIVFVSRTNVLPHY*HAA* -4.637 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21769 TPNVYHNGDGRVPLHCSLSL 20 SLAY-screened peptide P119 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGCCGAACGTTTATCACAATGGCGACGGTCGTGTGCCTCTTCATTGCAGTCTGTCGCTCTAA TPNVYHNGDGRVPLHCSLSL* -4.628 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21770 RFRGHHNVNSWFVIFSHHHD 20 SLAY-screened peptide P120 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGTTTTCGGGGTCACCATAATGTTAATTCTTGGTTTGTCATTTTTTCTCATCACCATGATTAA RFRGHHNVNSWFVIFSHHHD* -4.61 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21771 PT 2 SLAY-screened peptide P121 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTACCTAGCTGGTTTGGAGTGAGTATTTGCGTCTCTATCACGTTATTCTTTTTGCTCTTTAA PT*LVWSEYLRLYHVILFAL* -4.604 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21772 RTEVLPYRNTQSGIPNYEFS 20 SLAY-screened peptide P122 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGACTGAGGTTCTCCCTTACCGTAATACGCAGTCTGGTATTCCGAATTATGAGTTTAGTTAA RTEVLPYRNTQSGIPNYEFS* -4.593 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21773 ADMLLHRSNSNEHDHCAILL 20 SLAY-screened peptide P123 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGGACATGCTGTTGCATCGGTCGAACAGTAACGAGCATGATCATTGTGCGATTTTGCTCTAA ADMLLHRSNSNEHDHCAILL* -4.587 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21774 VPLAVASEPGPTLNGPPRAT 20 SLAY-screened peptide P124 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTTCCCCTCGCCGTCGCTAGCGAGCCTGGCCCCACTTTGAACGGCCCTCCCCGGGCCACTTAA VPLAVASEPGPTLNGPPRAT* -4.526 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21775 TFAITDMFSETNSITRFN 18 SLAY-screened peptide P125 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTTTTGCTATTACTGACATGTTCTCGGAGACCAATAGTATTACTCGTTTTAACTAGCTCTAA TFAITDMFSETNSITRFN*L* -4.493 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21776 LLPPGDLYQNRHIFPECNHN 20 SLAY-screened peptide P126 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTCTGCCTCCTGGCGATCTCTATCAGAATCGCCATATCTTCCCGGAGTGCAACCATAATTAA LLPPGDLYQNRHIFPECNHN* -4.489 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21777 PHGHSFHVYISLLFY 15 SLAY-screened peptide P127 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTCACGGGCATAGCTTTCACGTCTATATTTCTCTTCTTTTTTACTAGGGGCTGGTGAATTAA PHGHSFHVYISLLFY*GLVN* -4.481 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21778 CRTTSNHPLEIRRYCMYHGR 20 SLAY-screened peptide P128 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCCGTACTACTAGTAATCATCCTCTGGAGATTCGGAGGTATTGCATGTACCACGGGAGGTAA CRTTSNHPLEIRRYCMYHGR* -4.468 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21779 THKFHHRGRGYHSPNACLAG 20 SLAY-screened peptide P129 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTCATAAGTTCCACCATCGGGGTCGCGGTTATCATTCTCCTAATGCTTGTCTTGCCGGCTAA THKFHHRGRGYHSPNACLAG* -4.452 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21780 NDLYIGLYELMVNPARDHPN 20 SLAY-screened peptide P130 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACGACCTGTATATTGGGCTGTACGAGCTTATGGTTAATCCTGCTAGGGATCATCCTAATTAA NDLYIGLYELMVNPARDHPN* -4.447 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21781 ANLLLTLFMLTLRVGLAILSN 21 SLAY-screened peptide P131 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCAACTTGCTGCTAACCCTATTCATGCTAACCTTACGTGTCGGGCTTGCTATACTATCTAAC ANLLLTLFMLTLRVGLAILSN -4.402 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21782 NPFLGSGSIGLFHRSMCCIL 20 SLAY-screened peptide P132 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATCCGTTTCTTGGTAGCGGCTCTATCGGCCTGTTTCACAGGTCGATGTGCTGTATTTTGTAA NPFLGSGSIGLFHRSMCCIL* -4.385 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21783 RLHFGRGARVHVHYGMGAVH 20 SLAY-screened peptide P133 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGGCTTCATTTCGGCCGTGGTGCGCGCGTGCATGTCCATTATGGGATGGGTGCGGTCCACTAA RLHFGRGARVHVHYGMGAVH* -4.384 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21784 RLASNHNPHHLHTSHQE 17 SLAY-screened peptide P134 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCTTGGCCTCTAATCACAATCCGCATCATCTGCATACTAGTCATCAGGAGTAACTGAGTAAG RLASNHNPHHLHTSHQE*LSK -4.38 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21785 LVDGSWYSRPYVHSAGPPRV 20 SLAY-screened peptide P135 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTGTCGATGGTAGTTGGTATTCTCGGCCCTACGTTCATAGCGCCGGTCCGCCCCGGGTTTAA LVDGSWYSRPYVHSAGPPRV* -4.376 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21786 LAGACPLHNSPNNGF 15 SLAY-screened peptide P136 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCGCTGGTGCCTGTCCTCTGCATAACTCTCCTAATAATGGTTTCTAGGTTTAGATCGTCTAA LAGACPLHNSPNNGF*V*IV* -4.374 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21787 SPISNTA 7 SLAY-screened peptide P137 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTCCTATTAGTAATACTGCCTAGACGCGTTTTCCTCATCGTGACTGTAAGTGTGCGAATTAA SPISNTA*TRFPHRDCKCAN* -4.371 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21788 SPIHAHCCTTNYHDIIVDFV 20 SLAY-screened peptide P138 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGTCCGATCCATGCTCACTGTTGCACGACTAACTACCACGATATTATTGTTGATTTTGTTTAA SPIHAHCCTTNYHDIIVDFV* -4.366 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21789 RWALEPHSIWFHLKKMHLT 19 SLAY-screened peptide P139 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGGTGGGCGCTGGAGCCCCACTCTATCTGGTTTCACCTGAAGAAGATGCACCTCACTTAGTAA RWALEPHSIWFHLKKMHLT** -4.364 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21790 TVPRSERCRYCQLTDYLFSC 20 SLAY-screened peptide P140 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTGTGCCTCGCTCTGAGCGCTGCCGGTACTGTCAGCTGACTGATTATTTGTTTTCGTGTTAA TVPRSERCRYCQLTDYLFSC* -4.358 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21791 PLG 3 SLAY-screened peptide P141 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCCTTGGGTAGTATCTTGACAACCATTCTTATCGTTTCTATTGGTGCAAGACGACCCACTAA PLG*YLDNHSYRFYWCKTTH* -4.341 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21792 WSGVTHPNLLAILGIVCCLL 20 SLAY-screened peptide P142 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGGTCTGGTGTCACTCACCCTAATCTTCTCGCTATCCTTGGTATTGTTTGTTGCCTGCTTTAA WSGVTHPNLLAILGIVCCLL* -4.332 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21793 PH 2 SLAY-screened peptide P143 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTCATTAGACCATTACGTATAATGATAACAAGAGCCTTATTCCGGCTACTTTGAATTCGTAA PH*TITYNDNKSLIPATLNS* -4.319 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21794 LA 2 SLAY-screened peptide P144 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTGCTTAGCCGATTCACCTCTTCAATACTAATCACCCTAATATTGACTATTTTTATCTCTAA LA*PIHLFNTNHPNIDYFYL* -4.318 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21795 AIEVHAAWMLVPC 13 SLAY-screened peptide P145 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGATTGAGGTGCATGCGGCGTGGATGCTCGTTCCGTGCTAGACGGCGAATACGGCCAACTAA AIEVHAAWMLVPC*TANTAN* -4.285 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21796 QLDNHHLLHLNLRYGCRAYL 20 SLAY-screened peptide P146 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGCTGGACAATCACCATCTGCTTCATCTTAACCTGCGTTATGGTTGCCGTGCCTATTTGTAA QLDNHHLLHLNLRYGCRAYL* -4.245 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21797 HWYYVHFRDHSSLYTLLPDL 20 SLAY-screened peptide P147 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACACTGGTACTATGTTCATTTCCGTGACCATTCGAGTCTCTATACCCTGCTTCCTGACCTTTAA HWYYVHFRDHSSLYTLLPDL* -4.236 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21798 RAAFNRLTRFCAYVYSWQ 18 SLAY-screened peptide P148 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGTGCTGCTTTTAATCGCCTTACTCGTTTTTGCGCCTATGTTTATTCTTGGCAGTAGTAGTAA RAAFNRLTRFCAYVYSWQ*** -4.223 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21799 SRFHPVVNAARPNAHEGYSA 20 SLAY-screened peptide P149 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCCGGTTCCATCCTGTGGTTAACGCTGCTCGTCCTAATGCGCACGAGGGGTATAGCGCTTAA SRFHPVVNAARPNAHEGYSA* -4.211 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21800 LLTTPYSQLSNAVYLPCS 18 SLAY-screened peptide P150 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGCTCACTACTCCTTATTCCCAGTTGTCGAATGCGGTTTATTTGCCCTGCAGCTAGTTTTAA LLTTPYSQLSNAVYLPCS*F* -4.185 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21801 TPLRRHYSIRWLYVRIRRRN 20 SLAY-screened peptide P151 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCCCCCTTCGCCGGCATTACAGCATTCGTTGGCTGTACGTGCGTATTAGGCGTAGGAATTAA TPLRRHYSIRWLYVRIRRRN* -4.174 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21802 ATRRTATNLLGERTDAHTYR 20 SLAY-screened peptide P152 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTACTCGCCGGACTGCGACTAATCTTCTTGGTGAGCGTACTGATGCCCATACTTATAGGTAA ATRRTATNLLGERTDAHTYR* -4.169 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21803 AFTDDAVRIPGRRCTTFNCS 20 SLAY-screened peptide P153 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTTTTACTGACGATGCTGTTCGGATTCCGGGTAGGCGTTGTACTACGTTCAACTGCAGCTAA AFTDDAVRIPGRRCTTFNCS* -4.164 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21804 TFPPVHLSSDAILGDLHHAG 20 SLAY-screened peptide P154 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTTTTCCGCCGGTGCATCTGTCTTCTGACGCGATTTTGGGCGATCTTCACCATGCTGGTTAA TFPPVHLSSDAILGDLHHAG* -4.162 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21805 AMQIPNSLCAISS 13 SLAY-screened peptide P155 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTATGCAGATTCCCAACTCTCTTTGCGCTATTAGTTCTTAGAATAACCCTTATGGTCTTTAA AMQIPNSLCAISS*NNPYGL* -4.146 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21806 NVSLDNHGMLPGMLKSFYC 19 SLAY-screened peptide P156 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACGTCTCCCTCGACAATCACGGTATGCTTCCTGGTATGCTTAAGAGCTTTTATTGCTAGTAA NVSLDNHGMLPGMLKSFYC** -4.126 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21807 AGGYRHYMYGPHDWRFHRFY 20 SLAY-screened peptide P157 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCGGCGGCTATCGCCACTATATGTATGGTCCTCATGATTGGCGCTTTCATCGGTTTTATTAA AGGYRHYMYGPHDWRFHRFY* -4.125 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21808 MYNSASDETTSSHSNTGNYN 20 SLAY-screened peptide P158 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATGTATAATAGCGCCTCTGATGAGACTACCTCCTCTCATAGTAATACTGGTAATTATAATTAA MYNSASDETTSSHSNTGNYN* -4.12 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21809 CPFTVSDTSASYRSTRSFYS 20 SLAY-screened peptide P159 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCCCTTTCACTGTGTCTGATACCTCTGCGTCTTATCGTTCTACTCGTTCGTTTTATTCTTAA CPFTVSDTSASYRSTRSFYS* -4.113 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21810 LATSTLDYHSHLYSGPNSYG 20 SLAY-screened peptide P160 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCGCGACGTCCACGCTGGACTATCACAGTCACTTGTACAGCGGGCCTAACAGCTACGGTTAA LATSTLDYHSHLYSGPNSYG* -4.093 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21811 THDLAHNNNYFRVGSYLRLY 20 SLAY-screened peptide P161 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCCACGACTTGGCGCACAACAACAATTATTTTCGCGTCGGTAGTTATCTTCGTCTTTATTAA THDLAHNNNYFRVGSYLRLY* -4.084 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21812 MALWNPLLCKANHDLYLDAN 20 SLAY-screened peptide P162 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATGGCCTTGTGGAACCCTCTGCTGTGCAAGGCTAACCATGATCTGTATTTGGATGCTAACTAA MALWNPLLCKANHDLYLDAN* -4.062 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21813 KGVPVHIMPGAFFPSLVAGR 20 SLAY-screened peptide P163 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAAGGGTGTTCCTGTTCACATCATGCCTGGTGCTTTTTTCCCTTCTCTGGTTGCGGGCCGGTAA KGVPVHIMPGAFFPSLVAGR* -4.061 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21814 RLVSAEQHHNNSSYLAFMNE 20 SLAY-screened peptide P164 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGCTTGTGTCTGCCGAGCAGCATCACAATAATAGTAGTTATCTGGCCTTTATGAATGAGTAA RLVSAEQHHNNSSYLAFMNE* -4.057 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21815 LVCLCDCFQPDRTGSSVSED 20 SLAY-screened peptide P165 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTGTCTGCTTGTGTGATTGTTTCCAGCCCGATCGCACTGGTTCTAGTGTCTCTGAGGATTAA LVCLCDCFQPDRTGSSVSED* -4.035 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21816 TSNSPKALGNTASMSPMCHI 20 SLAY-screened peptide P166 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTTCTAATTCTCCTAAGGCTCTGGGGAATACGGCCTCGATGAGCCCGATGTGCCATATTTAA TSNSPKALGNTASMSPMCHI* -4.022 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21817 NCAFERPNHPSPYYDFEYTI 20 SLAY-screened peptide P167 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATTGCGCGTTTGAGCGTCCTAACCACCCTTCTCCGTATTATGACTTTGAGTATACTATTTAA NCAFERPNHPSPYYDFEYTI* -4.017 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21818 EPNHHSAVTGNRNNSATDND 20 SLAY-screened peptide P168 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGAGCCCAATCATCACTCTGCTGTTACGGGTAATCGTAACAATAGCGCGACTGATAATGATTAA EPNHHSAVTGNRNNSATDND* -3.984 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21819 PDSPIVVVAQHKRPCDTLPF 20 SLAY-screened peptide P169 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCGATAGTCCGATTGTGGTTGTTGCTCAGCATAAGCGTCCCTGTGATACGCTTCCTTTCTAA PDSPIVVVAQHKRPCDTLPF* -3.959 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21820 GHSPSLHCTMVIVIDGDNVT 20 SLAY-screened peptide P170 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGGCATTCTCCTTCTTTGCATTGTACGATGGTGATCGTTATTGATGGCGACAATGTCACTTAA GHSPSLHCTMVIVIDGDNVT* -3.949 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21821 PTRTEQWSTSNDSERTCLIL 20 SLAY-screened peptide P171 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCACCCGGACGGAGCAGTGGAGTACTTCCAACGATAGTGAGCGGACGTGCCTCATTTTGTAA PTRTEQWSTSNDSERTCLIL* -3.936 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21822 CGHCHTCTIPYCGNLIVAIHY 21 SLAY-screened peptide P172 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCGGCCATTGCCACACCTGCACCATTCCTTATTGCGGTAATCTTATTGTTGCTATCCACTAC CGHCHTCTIPYCGNLIVAIHY -3.921 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21823 PADTFFLLP 9 SLAY-screened peptide P173 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTGCTGATACTTTCTTTCTGCTTCCGTAGCCTCGCATTGATTCCACCCACCGTCAGGCGTAA PADTFFLLP*PRIDSTHRQA* -3.919 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21824 TVTSETLYFRLTCYTSRP 18 SLAY-screened peptide P174 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTGTGACGAGTGAGACCCTTTACTTCAGGCTGACTTGCTATACGTCGCGTCCTTAGCCTTAA TVTSETLYFRLTCYTSRP*P* -3.91 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21825 PRSTDVARRPGLSTV 15 SLAY-screened peptide P175 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCCGGAGTACTGATGTGGCGCGGCGCCCTGGCCTCAGTACTGTTTAGACGCTTCAGACGTAA PRSTDVARRPGLSTV*TLQT* -3.901 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21826 TSPATYRHTNWRGAPPLPNT 20 SLAY-screened peptide P176 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTTCTCCGGCTACTTACAGGCATACCAACTGGCGTGGTGCGCCGCCGCTCCCGAACACCTAA TSPATYRHTNWRGAPPLPNT* -3.884 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21827 SHLDNCTSVYNAANYTLMIG 20 SLAY-screened peptide P177 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTCATCTCGATAATTGTACTAGTGTTTATAATGCCGCTAACTATACTTTGATGATTGGCTAA SHLDNCTSVYNAANYTLMIG* -3.882 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21828 ISSLR 5 SLAY-screened peptide P178 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATCTCGAGCTTGCGTTAGACTGAGATTCCTCCTGCGTGTGGCCACACTATTTCGTCGATGTAA ISSLR*TEIPPACGHTISSM* -3.88 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21829 LMYNATYDH 9 SLAY-screened peptide P179 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTATGTACAATGCTACTTATGATCACTAGCCTAATACCAACCTTACCAATGCCATGAATTAA LMYNATYDH*PNTNLTNAMN* -3.873 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21830 TLHAGLYSVIIMFYGRWVSN 20 SLAY-screened peptide P180 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGCTGCATGCCGGCCTGTATTCTGTTATTATTATGTTTTACGGTCGTTGGGTTTCTAATTAA TLHAGLYSVIIMFYGRWVSN* -3.868 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21831 PAEWSTVVGNFTYHFNYNLL 20 SLAY-screened peptide P181 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGGCGGAGTGGTCGACTGTTGTGGGTAATTTTACGTACCATTTCAATTATAATCTCTTGTAA PAEWSTVVGNFTYHFNYNLL* -3.866 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21832 TLYIITYWDPDYKNIVSLTI 20 SLAY-screened peptide P182 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTTTGTACATTATTACGTATTGGGATCCTGATTACAAGAATATTGTTTCGCTTACGATTTAA TLYIITYWDPDYKNIVSLTI* -3.866 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21833 HPITIPNLLLAYRMPVLMLF 20 SLAY-screened peptide P183 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACACCCCATTACTATTCCTAATCTTCTTTTGGCTTACCGCATGCCTGTTCTCATGCTGTTTTAA HPITIPNLLLAYRMPVLMLF* -3.852 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21834 GDCTHKYADLPNAISNLFLR 20 SLAY-screened peptide P184 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGTGATTGCACTCACAAGTATGCTGATCTCCCTAATGCTATCAGCAACCTTTTTTTGCGCTAA GDCTHKYADLPNAISNLFLR* -3.849 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21835 GHVAMDPNINAVFHTTADTS 20 SLAY-screened peptide P185 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGCCACGTGGCCATGGATCCCAACATCAATGCTGTCTTTCACACTACTGCTGATACTTCTTAA GHVAMDPNINAVFHTTADTS* -3.846 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21836 IKTPKLDPN 9 SLAY-screened peptide P186 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTAAGACGCCTAAGCTTGATCCTAATTAGTGCATTTGCAAGATTCCTGTGCTTTACCGTTAA IKTPKLDPN*CICKIPVLYR* -3.846 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21837 HNFPCVYLARRRSSTRRGRVT 21 SLAY-screened peptide P187 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACACAACTTTCCGTGTGTCTACCTTGCCAGGCGCCGTTCATCAACTCGCCGAGGTCGAGTAACT HNFPCVYLARRRSSTRRGRVT -3.838 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21838 PSHGLDSSRRTHCNYIRTCE 20 SLAY-screened peptide P188 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTAGCCATGGTCTTGATTCTTCGCGTCGCACGCATTGCAACTATATTCGCACTTGTGAGTAA PSHGLDSSRRTHCNYIRTCE* -3.836 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21839 SVRGRCCSGEYARSRAVGTP 20 SLAY-screened peptide P189 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTGTTCGTGGTCGGTGTTGTAGCGGTGAGTATGCGCGGTCTCGGGCTGTGGGGACCCCCTAA SVRGRCCSGEYARSRAVGTP* -3.831 0.000023 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21840 PLQSPALATVMRIDHPTPTV 20 SLAY-screened peptide P190 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGCTGCAGAGTCCCGCTTTGGCGACGGTTATGCGTATCGACCACCCGACTCCGACCGTTTAA PLQSPALATVMRIDHPTPTV* -3.824 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21841 NICDTYILRDNRPFLT 16 SLAY-screened peptide P191 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATATTTGTGATACTTACATTCTGCGCGACAATCGTCCTTTCTTGACGTAGATCAGCATTAAC NICDTYILRDNRPFLT*ISIN -3.808 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21842 WPPPNYQRHDALKEEETSNL 20 SLAY-screened peptide P192 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGGCCCCCGCCGAATTACCAGCGCCACGATGCTCTCAAGGAGGAGGAGACGTCCAATTTGTAA WPPPNYQRHDALKEEETSNL* -3.803 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21843 VLLQY 5 SLAY-screened peptide P193 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTCCTTTTGCAGTACTAGCCTAAAATTAGGGCTGGAGCAGCTACGGTTACAACACTACTTAAC VLLQY*PKIRAGAATVTTLLN -3.795 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21844 PPGPANHAHHICIWPSEPAH 20 SLAY-screened peptide P194 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGCCGGGCCCTGCTAATCACGCTCACCATATTTGCATTTGGCCCTCGGAGCCCGCCCATTAA PPGPANHAHHICIWPSEPAH* -3.762 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21845 HVIASGCAVLLNYFRVMLPS 20 SLAY-screened peptide P195 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATGTTATCGCCAGCGGTTGCGCTGTTTTGCTTAACTATTTTAGGGTTATGCTTCCTTCCTAA HVIASGCAVLLNYFRVMLPS* -3.755 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21846 DHHRFIAPDISLARYFILYT 20 SLAY-screened peptide P196 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATCATCACCGTTTCATTGCCCCTGATATTTCTCTTGCTAGGTACTTTATTCTGTATACGTAA DHHRFIAPDISLARYFILYT* -3.753 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21847 PSSSQVPGDHFHFSNYVTFLY 21 SLAY-screened peptide P197 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTAGTTCCTCCCAGGTTCCCGGTGATCACTTTCACTTTAGCAATTATGTTACCTTCTTGTAC PSSSQVPGDHFHFSNYVTFLY -3.753 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21848 LFNLMSILNPDFSYYTNASN 20 SLAY-screened peptide P198 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTTTTAACCTTATGTCTATTCTTAATCCTGACTTTAGCTACTATACTAACGCTTCTAATTAA LFNLMSILNPDFSYYTNASN* -3.748 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21849 STYF 4 SLAY-screened peptide P199 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTACTTACTTTTAGCTCTGTCACTATCTTCGTAACATTTCTCGGCAGAAGGGTGAGGCCTAA STYF*LCHYLRNISRQKGEA* -3.733 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21850 SNSCLSSPCNIHYSVIPDRN 20 SLAY-screened peptide P200 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCGAATTCTTGCCTTTCTAGTCCTTGTAACATTCATTATAGTGTCATCCCTGATAGGAACTAA SNSCLSSPCNIHYSVIPDRN* -3.722 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21851 MQARPHWFSHDL 12 SLAY-screened peptide P201 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATGCAGGCTCGCCCCCACTGGTTCTCGCATGACCTGTAGTAGTGTAACTTGGATTATTATTAA MQARPHWFSHDL**CNLDYY* -3.697 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21852 NAPIISVCYCSTQILCLGDI 20 SLAY-screened peptide P202 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACGCGCCTATTATCAGTGTCTGTTATTGCAGTACTCAGATTCTCTGCCTTGGTGATATTTAA NAPIISVCYCSTQILCLGDI* -3.692 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21853 NRPNM 5 SLAY-screened peptide P203 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATCGTCCGAACATGTAGAAGTGCGGCACTTTGCCGCCTCGTTTTTAGGTTGCTATTGTCTAA NRPNM*KCGTLPPRF*VAIV* -3.684 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21854 PMHYLGSTTLKKNHLYHDSIN 21 SLAY-screened peptide P204 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTATGCATTACCTCGGTTCTACTACTCTTAAGAAGAATCATCTGTACCATGACTCGATTAAC PMHYLGSTTLKKNHLYHDSIN -3.683 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21855 ASDSPFQECDHLFYISNYIL 20 SLAY-screened peptide P205 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGAGTGATTCTCCTTTCCAGGAGTGTGACCATCTCTTTTACATTTCTAATTATATCCTGTAA ASDSPFQECDHLFYISNYIL* -3.682 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21856 RPFSKHSYNTDNTDYYHSNC 20 SLAY-screened peptide P206 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGGCCCTTTTCTAAGCACTCCTACAACACGGATAATACTGATTATTATCATTCTAACTGCTAA RPFSKHSYNTDNTDYYHSNC* -3.675 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21857 LNMLLYSTFRFTCSGNDHYH 20 SLAY-screened peptide P207 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTAACATGCTTCTTTACTCGACTTTTAGGTTTACGTGTTCGGGTAACGATCACTATCACTAA LNMLLYSTFRFTCSGNDHYH* -3.673 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21858 LLVSYCNGDIKHCHPNNSFS 20 SLAY-screened peptide P208 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGCTCGTGTCTTATTGCAATGGTGACATTAAGCATTGCCACCCTAATAATTCGTTTTCTTAA LLVSYCNGDIKHCHPNNSFS* -3.656 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21859 PLCYTLHSHNYNAAYYSSLS 20 SLAY-screened peptide P209 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTCTTTGTTACACGCTGCACTCCCATAATTATAATGCTGCTTATTATTCGAGTCTGTCGTAA PLCYTLHSHNYNAAYYSSLS* -3.656 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21860 PKTPASYCTIIVMVDNTVSL 20 SLAY-screened peptide P210 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCAAGACGCCCGCGTCTTACTGTACGATTATCGTTATGGTTGACAATACTGTTTCTCTGTAA PKTPASYCTIIVMVDNTVSL* -3.653 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21861 LFHSEFSDTQRSIHNISDYL 20 SLAY-screened peptide P211 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCTTTCATTCTGAGTTTAGTGATACTCAGAGGTCCATTCACAACATCAGCGATTACTTGTAA LFHSEFSDTQRSIHNISDYL* -3.648 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21862 WTSRFALLTKHFAIFVTILTN 21 SLAY-screened peptide P212 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGGACTTCCCGCTTTGCGCTCCTTACTAAGCACTTCGCTATCTTTGTAACCATCCTAACTAAC WTSRFALLTKHFAIFVTILTN -3.633 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21863 HHRNLQLYTFLSLLWTHYAA 20 SLAY-screened peptide P213 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACACCACCGTAATCTGCAGTTGTATACGTTCCTGTCTTTGCTGTGGACTCATTACGCCGCGTAA HHRNLQLYTFLSLLWTHYAA* -3.633 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21864 PYARSLGTGGNYIVNIIPRY 20 SLAY-screened peptide P214 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTTATGCCCGGAGCCTTGGCACTGGGGGTAATTATATTGTTAACATTATTCCTCGTTATTAA PYARSLGTGGNYIVNIIPRY* -3.631 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21865 SSNRHLGGSCQSPESDNYSIY 21 SLAY-screened peptide P215 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTTCTAACCGTCACTTGGGTGGTAGCTGTCAGAGTCCCGAGAGCGATAACTATAGTATTTAC SSNRHLGGSCQSPESDNYSIY -3.628 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21866 SDD 3 SLAY-screened peptide P216 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGTGACGATTAGTATACGTGTATGCCGATTCCCACGTATTTCCGTGTCAATCTCTTCCCCTAA SDD*YTCMPIPTYFRVNLFP* -3.623 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21867 PPCCVTPPSILSFAVATCAT 20 SLAY-screened peptide P217 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGCCTTGCTGCGTTACCCCGCCTAGCATCCTTAGTTTTGCTGTGGCTACGTGCGCGACGTAA PPCCVTPPSILSFAVATCAT* -3.612 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21868 ILVVSL 6 SLAY-screened peptide P218 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTCTCGTCGTCTCGTTGTAGCATCCTGGCGCCTATCCCTCCATGCTGTGGTCTACCACTTAA ILVVSL*HPGAYPSMLWSTT* -3.596 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21869 PNLHSGNRPLYNLFAYAAHG 20 SLAY-screened peptide P219 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTAATCTTCACTCTGGTAATAGGCCGCTCTATAATCTGTTTGCCTACGCTGCCCATGGTTAA PNLHSGNRPLYNLFAYAAHG* -3.591 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21870 HYFYLDVLAILPLHFKSIPC 20 SLAY-screened peptide P220 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACACTACTTCTATCTGGACGTGCTTGCTATTCTCCCGCTTCATTTTAAGAGTATTCCTTGTTAA HYFYLDVLAILPLHFKSIPC* -3.587 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21871 RDIITIRHCAYRHTPNTRIC 20 SLAY-screened peptide P221 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCGATATTATCACGATCAGGCACTGTGCGTATCGCCATACGCCTAACACTCGCATTTGCTAA RDIITIRHCAYRHTPNTRIC* -3.579 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21872 RHIAYHCNMLFSDFLDRFLE 20 SLAY-screened peptide P222 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGCATATTGCTTATCATTGCAACATGCTGTTTTCTGACTTTCTCGATCGTTTTCTCGAGTAA RHIAYHCNMLFSDFLDRFLE* -3.576 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21873 YSGTYTGFSNYCIVDCTI 18 SLAY-screened peptide P223 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATAGTGGCACGTATACTGGTTTCTCTAATTATTGCATTGTGGATTGTACCATCTAGTATTAA YSGTYTGFSNYCIVDCTI*Y* -3.574 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21874 PPYNLHTDN 9 SLAY-screened peptide P224 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTCCTTATAACCTTCACACTGATAATTAGTCTTTTCGGGACGAGTATCTTAAGTCTAGGTAA PPYNLHTDN*SFRDEYLKSR* -3.573 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21875 AWNYNYGKPPLGINLQYLRT 20 SLAY-screened peptide P225 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTTGGAATTACAATTACGGCAAGCCTCCTCTGGGTATCAACCTGCAGTATCTCCGGACCTAA AWNYNYGKPPLGINLQYLRT* -3.572 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21876 RPFHTTPNFSRCLYPRDSFL 20 SLAY-screened peptide P226 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGTCCTTTTCATACTACGCCTAACTTTAGCCGTTGTCTGTATCCGCGTGATTCTTTTCTCTAA RPFHTTPNFSRCLYPRDSFL* -3.571 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21877 PFGKHRSGLFPRHNSKTAQL 20 SLAY-screened peptide P227 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCTTTGGGAAGCATCGTTCTGGTCTTTTTCCTAGGCATAACAGCAAGACCGCGCAGCTGTAA PFGKHRSGLFPRHNSKTAQL* -3.569 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21878 PGGCPSLRMHDLDDTMHVLQ 20 SLAY-screened peptide P228 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTGGTGGCTGTCCTAGTCTTCGCATGCACGATCTCGATGATACTATGCACGTTCTTCAGTAA PGGCPSLRMHDLDDTMHVLQ* -3.565 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21879 RGSKDCAYPASSNLDSIILN 20 SLAY-screened peptide P229 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCGGTTCGAAGGACTGTGCTTACCCTGCTTCTTCTAATTTGGATTCCATTATTCTGAACTAA RGSKDCAYPASSNLDSIILN* -3.556 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21880 PILCDLGVAYAIPPFCDD 18 SLAY-screened peptide P230 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGATCCTTTGTGACCTGGGTGTTGCTTATGCGATTCCGCCTTTCTGTGATGATTAGACCTAA PILCDLGVAYAIPPFCDD*T* -3.553 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21881 RRARGVYTWYSNLPSAQRVP 20 SLAY-screened peptide P231 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGCGCGCTCGGGGCGTGTATACCTGGTATTCTAACCTTCCGTCGGCCCAGCGGGTTCCCTAA RRARGVYTWYSNLPSAQRVP* -3.543 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21882 RTLTFMVRIGAKMLFFEIRY 20 SLAY-screened peptide P232 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCACCCTCACCTTTATGGTTCGCATTGGGGCCAAGATGCTCTTTTTTGAGATTAGGTATTAA RTLTFMVRIGAKMLFFEIRY* -3.537 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21883 RMGSSYTSGIDLWLVLHHNN 20 SLAY-screened peptide P233 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGATGGGGTCTTCCTACACTTCTGGTATTGACCTGTGGCTGGTGCTGCATCATAATAATTAA RMGSSYTSGIDLWLVLHHNN* -3.535 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21884 PYWLGTLDRVNYLGPTGYAF 20 SLAY-screened peptide P234 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTTATTGGCTGGGTACTCTTGATCGCGTCAATTACCTTGGCCCCACGGGGTATGCCTTCTAA PYWLGTLDRVNYLGPTGYAF* -3.53 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21885 PGPYSKSLLSIRCADPN 17 SLAY-screened peptide P235 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGGGCCCTTACTCTAAGTCTCTGCTTTCTATTCGGTGTGCTGACCCTAACTAGAACGCTTAA PGPYSKSLLSIRCADPN*NA* -3.523 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21886 YRNTTTIR 8 SLAY-screened peptide P236 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATCGTAACACTACGACTATTCGTTAGGATCTCCATAGCAACGGCGACTCTAGTAGCCCTTAA YRNTTTIR*DLHSNGDSSSP* -3.521 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21887 SQTYCIWLRVRIRIAIIIRLN 21 SLAY-screened peptide P237 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCCAGACTTACTGCATTTGGTTACGCGTACGAATCCGCATAGCAATAATTATACGACTTAAC SQTYCIWLRVRIRIAIIIRLN -3.517 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21888 TNFHMLNYYASPGCSYKEPL 20 SLAY-screened peptide P238 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTAATTTCCATATGCTTAATTATTACGCCAGCCCGGGCTGCTCTTATAAGGAGCCCCTCTAA TNFHMLNYYASPGCSYKEPL* -3.514 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21889 RSNNVFTLPQNLHSANKLCP 20 SLAY-screened peptide P239 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGGTCGAATAATGTTTTTACGCTTCCTCAGAATCTTCATTCGGCTAATAAGCTCTGCCCTTAA RSNNVFTLPQNLHSANKLCP* -3.511 0.000006 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21890 VGTSSLNGDKVPNLPRRVIR 20 SLAY-screened peptide P240 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTTGGGACGTCTAGCCTTAATGGCGACAAGGTTCCTAATTTGCCTAGGAGGGTCATTCGTTAA VGTSSLNGDKVPNLPRRVIR* -3.506 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21891 VSVILRPNGLNLSVRLSYAC 20 SLAY-screened peptide P241 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTTTCTGTTATTCTTAGGCCTAACGGTCTTAACCTTTCTGTTCGTCTGAGCTACGCTTGCTAA VSVILRPNGLNLSVRLSYAC* -3.504 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21892 PPGGYHCDLYFLILRH 16 SLAY-screened peptide P242 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTCCGGGCGGGTATCATTGTGATTTGTATTTTCTTATTCTTCGTCACTAGCAGAAGTAGTAA PPGGYHCDLYFLILRH*QK** -3.497 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21893 RLALTFIHRLYHPNHLNFHS 20 SLAY-screened peptide P243 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCCTGGCGCTCACGTTCATCCACAGGCTTTATCATCCTAATCACCTTAACTTTCACTCTTAA RLALTFIHRLYHPNHLNFHS* -3.489 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21894 IRYGPPCSHNLREHLPKTLE 20 SLAY-screened peptide P244 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTAGGTATGGCCCGCCTTGTAGCCACAATCTTCGGGAGCATCTTCCGAAGACCCTCGAGTAA IRYGPPCSHNLREHLPKTLE* -3.478 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21895 GNLNFPIEWKARRMVEVKSQ 20 SLAY-screened peptide P245 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGGAATCTTAATTTTCCTATTGAGTGGAAGGCGCGTCGTATGGTTGAGGTCAAGTCCCAGTAA GNLNFPIEWKARRMVEVKSQ* -3.477 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21896 DIHAITRVPDTQLIHFVCIS 20 SLAY-screened peptide P246 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATATTCATGCGATCACTCGTGTCCCTGATACGCAGCTTATCCATTTTGTCTGCATTTCTTAA DIHAITRVPDTQLIHFVCIS* -3.471 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21897 QSTSNLHMSYTVNGTNVLGR 20 SLAY-screened peptide P247 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGTCCACTTCGAATCTCCATATGTCTTACACTGTCAACGGGACTAATGTCCTGGGGCGTTAA QSTSNLHMSYTVNGTNVLGR* -3.469 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21898 NSVDPIDSDIDMTYNALHSDY 21 SLAY-screened peptide P248 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACTCGGTTGATCCTATTGATTCTGACATTGATATGACTTATAATGCCTTGCATAGTGATTAC NSVDPIDSDIDMTYNALHSDY -3.465 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21899 PPVRKRITVSYHILFNKNND 20 SLAY-screened peptide P249 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTCCCGTCCGTAAGCGTATCACCGTTAGTTATCATATTTTGTTTAATAAGAATAACGACTAA PPVRKRITVSYHILFNKNND* -3.454 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21900 PSDLVPTLSPNNRGPPEYSP 20 SLAY-screened peptide P250 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTTCGGACCTGGTTCCCACTCTTTCTCCGAACAACCGCGGCCCGCCGGAGTACTCTCCCTAA PSDLVPTLSPNNRGPPEYSP* -3.453 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21901 TCMHNNWLPLATLSDRRHLF 20 SLAY-screened peptide P251 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTTGTATGCATAATAATTGGCTTCCGCTTGCGACCCTGAGCGACAGGAGGCATTTGTTTTAA TCMHNNWLPLATLSDRRHLF* -3.452 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21902 TGRGRHPHGTRTVRIATPNN 20 SLAY-screened peptide P252 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCGGCCGGGGTAGGCACCCTCACGGCACTCGTACGGTTCGTATTGCTACGCCGAACAATTAA TGRGRHPHGTRTVRIATPNN* -3.45 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21903 STPGLCTTASPPFVP 15 SLAY-screened peptide P253 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCGACCCCCGGTCTTTGCACCACCGCGAGTCCTCCTTTCGTGCCGTAGACGATCTACTACTAA STPGLCTTASPPFVP*TIYY* -3.449 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21904 CPPLLGYSARDRLSIYGSIV 20 SLAY-screened peptide P254 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGTCCTCCTCTCCTGGGGTACTCCGCTAGGGACCGTCTCAGTATTTATGGTTCGATTGTGTAA CPPLLGYSARDRLSIYGSIV* -3.447 0.000002 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21905 SSYNAHMM 8 SLAY-screened peptide P255 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCAGTTACAATGCTCATATGATGTAGGGTTGGCATAGCACCATCAATACTTTTAAGTGTTAA SSYNAHMM*GWHSTINTFKC* -3.447 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21906 ANSLCFIRGPPSFISKLHNI 20 SLAY-screened peptide P256 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCAACTCGCTCTGTTTTATCCGGGGTCCGCCGTCCTTTATCAGCAAGCTTCATAATATTTAA ANSLCFIRGPPSFISKLHNI* -3.446 0.000017 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21907 KCCSPDTCPTVPEIHMPLSS 20 SLAY-screened peptide P257 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAAGTGCTGTAGTCCTGACACTTGCCCTACGGTTCCTGAGATTCATATGCCTCTCTCGAGTTAA KCCSPDTCPTVPEIHMPLSS* -3.444 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21908 HYHRFATGATRSSYHTHAFI 20 SLAY-screened peptide P258 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATTACCATCGCTTCGCCACGGGTGCTACGCGCAGCTCTTACCATACTCATGCGTTTATTTAA HYHRFATGATRSSYHTHAFI* -3.444 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21909 TSVDPNICICILFGHLSGYY 20 SLAY-screened peptide P259 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTTCCGTGGATCCTAACATTTGTATCTGTATCCTTTTTGGTCATCTCAGTGGTTACTATTAA TSVDPNICICILFGHLSGYY* -3.443 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21910 CPTSALPSSGLLTVPTYASS 20 SLAY-screened peptide P260 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCCCCACCTCGGCGCTCCCGTCCTCGGGGCTTCTCACTGTGCCTACTTACGCGTCGAGTTAA CPTSALPSSGLLTVPTYASS* -3.44 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21911 TYTQ 4 SLAY-screened peptide P261 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCTACACGCAGTAGAAGCATTGGCAGGACCCGCACGCGGCTACGACTTCGTCCGAGAATTAA TYTQ*KHWQDPHAATTSSEN* -3.423 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21912 DTLFHPKLHPHSAPTCTM 18 SLAY-screened peptide P262 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATACCTTGTTTCACCCCAAGCTGCATCCCCATTCCGCCCCTACTTGCACCATGTAGTTCTAA DTLFHPKLHPHSAPTCTM*F* -3.421 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21913 YPIRHSLPYAPYMFRTVACP 20 SLAY-screened peptide P263 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATCCTATTAGGCATTCTCTTCCTTACGCTCCGTATATGTTCCGCACTGTCGCTTGCCCGTAA YPIRHSLPYAPYMFRTVACP* -3.421 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21914 PC 2 SLAY-screened peptide P264 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGTGCTAGGGTGACGGGTCGAGTATTAACAGGTATAGCGCCCCGGCGTAGGCGTTCCACTAA PC*GDGSSINRYSAPA*AFH* -3.42 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21915 ATCEFWRECT 10 SLAY-screened peptide P265 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTACTTGTGAGTTCTGGAGGGAGTGCACCTAGCGGGCTTACGTTTACTCTGGTATTCTTTAA ATCEFWRECT*RAYVYSGIL* -3.416 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21916 MLCPHYSGHSRYTVRTFCKN 20 SLAY-screened peptide P266 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATGCTTTGTCCGCACTACTCTGGCCACAGTAGGTATACGGTTCGTACTTTTTGTAAGAACTAA MLCPHYSGHSRYTVRTFCKN* -3.415 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21917 LIILCYTTRSSIDTKYVPS 19 SLAY-screened peptide P267 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTATTATCCTTTGTTACACTACTCGTTCTAGTATCGACACGAAGTATGTTCCGTCCTAGTAA LIILCYTTRSSIDTKYVPS** -3.412 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21918 GVVCYLATDSPGTYPGSLSL 20 SLAY-screened peptide P268 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGCGTCGTGTGCTATCTTGCGACTGATTCGCCGGGCACTTATCCTGGGTCTCTCAGTTTGTAA GVVCYLATDSPGTYPGSLSL* -3.408 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21919 ELWPYFPSSYDLLCMPVDTY 20 SLAY-screened peptide P269 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGAGCTCTGGCCCTACTTTCCGTCCTCCTACGATCTCCTCTGCATGCCTGTGGACACCTACTAA ELWPYFPSSYDLLCMPVDTY* -3.402 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21920 AGRNFPNCLCGLDAMTSSDI 20 SLAY-screened peptide P270 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCGGGAGGAATTTCCCTAACTGCCTCTGTGGGCTGGATGCTATGACGAGTTCTGACATCTAA AGRNFPNCLCGLDAMTSSDI* -3.399 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21921 IPPQCPGILLPAYAFSVDSI 20 SLAY-screened peptide P271 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATCCCGCCTCAGTGCCCTGGTATCCTGCTTCCGGCGTATGCTTTTTCCGTTGACAGTATTTAA IPPQCPGILLPAYAFSVDSI* -3.391 0.000002 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21922 RVHAVPPPGSHFPFLTRAGCN 21 SLAY-screened peptide P272 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGTGTTCATGCGGTTCCGCCGCCGGGCTCTCACTTTCCCTTCCTCACGCGGGCAGGATGTAAC RVHAVPPPGSHFPFLTRAGCN -3.387 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21923 HAGMDSADFIEYSASNKAHL 20 SLAY-screened peptide P273 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACACGCTGGCATGGATTCTGCGGATTTTATCGAGTATTCGGCGAGTAACAAGGCTCATCTTTAA HAGMDSADFIEYSASNKAHL* -3.375 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21924 SSFNWCPHRVFFCLSTKEVP 20 SLAY-screened peptide P274 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCTCTTTCAATTGGTGTCCGCATCGGGTTTTTTTCTGTCTTTCGACCAAGGAGGTCCCTTAA SSFNWCPHRVFFCLSTKEVP* -3.371 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21925 DICDNNIETNFQWTTDV 17 SLAY-screened peptide P275 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATATTTGTGATAATAATATTGAGACCAACTTTCAGTGGACCACTGACGTTTAGCTCCCTTAA DICDNNIETNFQWTTDV*LP* -3.368 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21926 QSTTLHTTCGYMSNENDEKG 20 SLAY-screened peptide P276 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGAGTACTACCTTGCATACTACTTGTGGTTATATGTCTAACGAGAATGACGAGAAGGGTTAA QSTTLHTTCGYMSNENDEKG* -3.363 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21927 FHILIARFRRARRFTIAVVIN 21 SLAY-screened peptide P277 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTCCACATCCTCATAGCCAGGTTCCGTCGAGCCCGTCGCTTCACGATTGCCGTCGTGATTAAC FHILIARFRRARRFTIAVVIN -3.355 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21928 SYYRIHQRIIVSSINAFTNY 20 SLAY-screened peptide P278 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGCTATTATCGTATCCACCAGCGGATCATTGTTTCGTCTATCAATGCTTTTACTAATTATTAA SYYRIHQRIIVSSINAFTNY* -3.342 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21929 PSPDLRAPSNHYNVYGTSH 19 SLAY-screened peptide P279 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTTCGCCCGACCTCAGGGCTCCTTCTAATCATTATAATGTTTACGGTACCTCGCACTAGTAA PSPDLRAPSNHYNVYGTSH** -3.339 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21930 ANCTHAIYNNFCHHDHAYRT 20 SLAY-screened peptide P280 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCAACTGTACCCATGCGATTTATAATAATTTCTGTCATCACGATCACGCCTACCGTACGTAA ANCTHAIYNNFCHHDHAYRT* -3.336 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21931 FLYHNFAMGWFIPGRPMYRA 20 SLAY-screened peptide P281 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTTCTCTACCACAACTTTGCTATGGGTTGGTTCATCCCCGGGCGCCCGATGTATAGGGCTTAA FLYHNFAMGWFIPGRPMYRA* -3.308 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21932 LMRTVGADSLSALFPDMGKP 20 SLAY-screened peptide P282 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCATGCGTACGGTCGGTGCTGATTCGCTGTCTGCTCTTTTTCCGGACATGGGCAAGCCCTAA LMRTVGADSLSALFPDMGKP* -3.299 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21933 EDPAPYTYIPHRYSSSISTH 20 SLAY-screened peptide P283 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGAGGACCCCGCCCCTTACACTTATATTCCTCATAGGTATTCGAGTTCTATCTCGACCCATTAA EDPAPYTYIPHRYSSSISTH* -3.299 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21934 GI 2 SLAY-screened peptide P284 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGTATTTAGAACCACGCTTTCTGGGTGCACAGTTATGTTCCGGGGAGGTAGACGGACACGTAA GI*NHAFWVHSYVPGR*TDT* -3.297 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21935 HSLSLSIRDSHINYECNNDS 20 SLAY-screened peptide P285 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATAGTTTGTCGCTTTCCATTAGGGATTCTCATATCAATTATGAGTGCAATAACGATTCGTAA HSLSLSIRDSHINYECNNDS* -3.297 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21936 QNLITNFVGGNERHILPIAF 20 SLAY-screened peptide P286 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGAATCTCATTACTAATTTCGTTGGGGGTAACGAGCGGCATATCTTGCCCATTGCCTTTTAA QNLITNFVGGNERHILPIAF* -3.296 0.000005 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21937 HANFSAPLTFLLTIRRRARG 20 SLAY-screened peptide P287 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATGCCAACTTCAGTGCCCCTCTCACTTTTTTGCTCACGATTCGCCGGCGGGCTAGGGGCTAA HANFSAPLTFLLTIRRRARG* -3.294 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21938 TITPAIPLPRIRSPPSCTFVT 21 SLAY-screened peptide P288 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCATTACTCCAGCGATCCCCTTGCCTCGAATTAGATCGCCACCAAGCTGTACATTCGTAACT TITPAIPLPRIRSPPSCTFVT -3.293 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21939 PNRQHLNFHYFCLMLHPPMP 20 SLAY-screened peptide P289 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTAACCGTCAGCATCTTAATTTTCATTATTTCTGCCTTATGCTCCATCCGCCCATGCCGTAA PNRQHLNFHYFCLMLHPPMP* -3.293 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21940 QGNHTLNPSFSANNSFCAIT 20 SLAY-screened peptide P290 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGGGCAATCATACTCTTAATCCTAGCTTTTCCGCCAATAATAGCTTTTGCGCTATTACCTAA QGNHTLNPSFSANNSFCAIT* -3.29 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21941 LHSTSIHAMSSHSRTINGKH 20 SLAY-screened peptide P291 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTCATAGCACTTCTATCCATGCTATGTCTAGCCATAGTCGTACTATCAACGGCAAGCACTAA LHSTSIHAMSSHSRTINGKH* -3.282 0.000002 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21942 IFDHDTHCSCNFHFIANGSW 20 SLAY-screened peptide P292 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTTTCGATCATGATACTCACTGTAGTTGCAATTTTCACTTTATCGCGAACGGCTCTTGGTAA IFDHDTHCSCNFHFIANGSW* -3.281 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21943 RKCVISVARRNRRANIKILCN 21 SLAY-screened peptide P293 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCAAGTGCGTTATCTCCGTGGCGCGCCGTAATCGTAGGGCCAACATCAAGATCTTATGTAAC RKCVISVARRNRRANIKILCN -3.271 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21944 EPTILPDSDNSWIYTLDFTK 20 SLAY-screened peptide P294 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGAGCCCACTATTCTCCCCGACTCCGATAATTCTTGGATTTATACTCTTGATTTTACTAAGTAA EPTILPDSDNSWIYTLDFTK* -3.266 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21945 HNSFDSLLFYRKMDECVVGA 20 SLAY-screened peptide P295 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACACAACTCTTTTGATTCGCTGCTCTTTTACCGTAAGATGGACGAGTGTGTTGTTGGGGCCTAA HNSFDSLLFYRKMDECVVGA* -3.262 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21946 LSMQ 4 SLAY-screened peptide P296 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGTCGATGCAGTAGTTCCCGGATCTTAGTCCGCGGTTGCGTTCGCATAGTGATACGTAACTG LSMQ*FPDLSPRLRSHSDT*L -3.254 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21947 IEAPSTVPPYPFTQSCYESW 20 SLAY-screened peptide P297 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATCGAGGCGCCCTCTACGGTTCCTCCTTATCCGTTTACTCAGAGCTGTTACGAGAGCTGGTAA IEAPSTVPPYPFTQSCYESW* -3.25 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21948 ISANYRSVFDSQHRVNDLLA 20 SLAY-screened peptide P298 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTAGCGCGAACTATCGCAGTGTCTTTGATAGCCAGCATCGTGTCAATGATCTTCTCGCCTAA ISANYRSVFDSQHRVNDLLA* -3.246 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21949 LAMPFIKYPLNSRDGVCTHP 20 SLAY-screened peptide P299 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTGCTATGCCGTTTATTAAGTACCCGTTGAACAGCCGTGACGGCGTTTGCACGCACCCCTAA LAMPFIKYPLNSRDGVCTHP* -3.246 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21950 ILLRNTGFITRVFQTCVEPV 20 SLAY-screened peptide P300 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTCTCCTTCGCAATACCGGTTTTATTACTCGGGTGTTCCAGACTTGCGTTGAGCCCGTTTAA ILLRNTGFITRVFQTCVEPV* -3.246 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21951 FTMYVVLLHIRQNL 14 SLAY-screened peptide P301 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTTACCATGTACGTGGTCCTTCTCCATATTCGCCAGAATCTCTAGGCCCCGGACGCCTGTTAA FTMYVVLLHIRQNL*APDAC* -3.244 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21952 SLDYNHRIDLSVLPYCLGPT 20 SLAY-screened peptide P302 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCGCTCGATTATAATCACCGTATCGACCTTTCTGTTCTTCCGTACTGCCTCGGTCCGACCTAA SLDYNHRIDLSVLPYCLGPT* -3.243 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21953 PRPRWPPPTTHTIVTPQDTL 20 SLAY-screened peptide P303 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTAGGCCGAGGTGGCCCCCTCCCACTACTCACACTATTGTTACTCCCCAGGACACGTTGTAA PRPRWPPPTTHTIVTPQDTL* -3.24 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21954 RLHATTYMHMHRDLMNFAFL 20 SLAY-screened peptide P304 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGGCTGCATGCTACCACGTATATGCATATGCATCGTGACTTGATGAACTTCGCGTTCCTGTAA RLHATTYMHMHRDLMNFAFL* -3.239 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21955 APYRRCSKNRLVLAS 15 SLAY-screened peptide P305 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTCCCTATCGGCGCTGCTCTAAGAACCGCTTGGTTCTGGCTTCCTAGCAGACGACGTAGTAA APYRRCSKNRLVLAS*QTT** -3.23 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21956 PRRAYFNFNGGSYDTVTISF 20 SLAY-screened peptide P306 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCAGGAGGGCGTACTTCAACTTCAACGGCGGTAGTTACGATACGGTCACTATTAGTTTCTAA PRRAYFNFNGGSYDTVTISF* -3.218 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21957 LGEAYECSTFNFGST 15 SLAY-screened peptide P307 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTGGCGAGGCTTATGAGTGCAGCACTTTCAATTTTGGCTCGACTTAGCACACTGTCGCTAAC LGEAYECSTFNFGST*HTVAN -3.209 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21958 VITPDRSGHFTFDHYYYWAS 20 SLAY-screened peptide P308 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTCATCACGCCGGACCGTTCCGGCCACTTTACGTTCGATCACTATTATTACTGGGCCAGTTAA VITPDRSGHFTFDHYYYWAS* -3.206 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21959 IGHLYHSYVSSCSRSGVGMS 20 SLAY-screened peptide P309 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATCGGTCATCTTTACCATAGCTACGTGTCTAGCTGCTCTAGGTCCGGTGTGGGTATGTCTTAA IGHLYHSYVSSCSRSGVGMS* -3.204 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21960 NAWYTVHYTHNFVIS 15 SLAY-screened peptide P310 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATGCGTGGTATACTGTTCACTACACTCATAATTTTGTCATCAGCTAGGACCATACGCAGTAA NAWYTVHYTHNFVIS*DHTQ* -3.202 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21961 DFLALSHYTCCSSNHIPPCH 20 SLAY-screened peptide P311 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATTTTTTGGCGCTCAGTCACTATACGTGTTGCTCTTCTAATCATATCCCTCCTTGTCACTAA DFLALSHYTCCSSNHIPPCH* -3.202 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21962 YSTMFHDHPGMGGFDRPPQL 20 SLAY-screened peptide P312 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATTCTACCATGTTCCATGATCACCCCGGTATGGGTGGTTTTGATCGTCCGCCCCAGCTGTAA YSTMFHDHPGMGGFDRPPQL* -3.201 0.000014 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21963 MQPHRRNYNTYSLFTDPSDT 20 SLAY-screened peptide P313 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATGCAGCCTCACCGCCGCAATTATAATACGTATAGTCTTTTTACTGACCCTAGCGATACCTAA MQPHRRNYNTYSLFTDPSDT* -3.198 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21964 HTVLPLYRTVTSKCSHTMGV 20 SLAY-screened peptide P314 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATACTGTCCTTCCTCTGTATCGGACCGTCACTTCTAAGTGCTCTCACACTATGGGTGTCTAA HTVLPLYRTVTSKCSHTMGV* -3.194 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21965 PYNVYHSFKHYHIYDDNWVP 20 SLAY-screened peptide P315 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCTACAACGTCTATCACAGTTTTAAGCATTACCATATCTATGACGACAATTGGGTGCCTTAA PYNVYHSFKHYHIYDDNWVP* -3.194 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21966 CLHCLCYSGSDCDNIYSFIS 20 SLAY-screened peptide P316 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGTTTGCATTGTTTGTGCTATTCTGGGAGTGACTGCGACAATATTTACTCTTTCATTTCCTAA CLHCLCYSGSDCDNIYSFIS* -3.192 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21967 LHAIFLHCCKIHAQCVTLYT 20 SLAY-screened peptide P317 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCCACGCCATTTTCCTGCATTGTTGCAAGATCCACGCTCAGTGCGTCACTTTGTATACTTAA LHAIFLHCCKIHAQCVTLYT* -3.19 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21968 PALHYVNFERYMPSDNRRL 19 SLAY-screened peptide P318 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTGCTTTGCATTACGTTAACTTCGAGCGGTATATGCCTTCGGACAATCGCCGGCTGTAGTAA PALHYVNFERYMPSDNRRL** -3.183 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21969 NLSLPDYNICMHREHPTILL 20 SLAY-screened peptide P319 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACCTGTCGCTTCCCGATTATAACATCTGCATGCACCGCGAGCACCCTACCATTCTCCTGTAA NLSLPDYNICMHREHPTILL* -3.181 0.000007 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21970 MRFNPTHIYSVPLMTLAPLIN 21 SLAY-screened peptide P320 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATGCGCTTTAACCCTACTCATATTTATAGCGTACCGTTGATGACACTGGCACCTCTAATTAAC MRFNPTHIYSVPLMTLAPLIN -3.179 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21971 DISHRVRSSDLFLHRPCISY 20 SLAY-screened peptide P321 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGACATCAGTCACCGTGTGCGTTCTTCCGATTTGTTCCTTCATCGTCCTTGCATTTCTTATTAA DISHRVRSSDLFLHRPCISY* -3.172 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21972 SLHYGPWHDIFNTPMSHYLW 20 SLAY-screened peptide P322 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCCTGCACTACGGTCCCTGGCATGATATTTTCAATACGCCCATGTCTCACTATCTTTGGTAA SLHYGPWHDIFNTPMSHYLW* -3.169 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21973 PCLYDSNCYCFNYCHRPNGE 20 SLAY-screened peptide P323 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCTGTCTCTATGATTCTAATTGCTATTGTTTCAATTACTGTCACAGGCCTAATGGCGAGTAA PCLYDSNCYCFNYCHRPNGE* -3.166 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21974 IATPCNLLDDVFDYTLATDS 20 SLAY-screened peptide P324 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTGCGACGCCCTGTAATTTGTTGGATGATGTTTTTGATTATACGCTGGCGACTGACTCTTAA IATPCNLLDDVFDYTLATDS* -3.165 0.000002 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21975 TSYLRYTPHTTLTIFIFVCPN 21 SLAY-screened peptide P325 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCAGCTACCTGCGTTATACTCCGCACACCACTCTCACTATTTTCATTTTTGTGTGTCCTAAC TSYLRYTPHTTLTIFIFVCPN -3.155 0.000002 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21976 CAASYIQDPASYACFNLKSA 20 SLAY-screened peptide P326 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCGCTGCTAGTTACATTCAGGATCCGGCTTCGTACGCCTGCTTTAACCTTAAGAGCGCTTAA CAASYIQDPASYACFNLKSA* -3.154 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21977 NSLA 4 SLAY-screened peptide P327 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATAGCTTGGCTTAGGAGCCTACGTTCTACGATGGTATTTATTATATTCCTAAAACTAGTAAC NSLA*EPTFYDGIYYIPKTSN -3.152 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21978 NYTRTHIQILAVPVITF 17 SLAY-screened peptide P328 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATTATACGCGTACTCACATTCAGATCCTGGCTGTTCCGGTGATTACTTTTTAGTATTATTAA NYTRTHIQILAVPVITF*YY* -3.152 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21979 LPETEALPYRCNIWITLNKE 20 SLAY-screened peptide P329 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGCCTGAGACCGAGGCTTTGCCTTATCGCTGTAATATCTGGATTACTCTTAATAAGGAGTAA LPETEALPYRCNIWITLNKE* -3.148 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21980 LNTSSRINCFYIDPPDHLFS 20 SLAY-screened peptide P330 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTAATACTAGTAGCCGCATTAATTGTTTTTACATTGACCCCCCTGACCATCTGTTTTCTTAA LNTSSRINCFYIDPPDHLFS* -3.147 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21981 RTNLLVMFSFLACMSIPMRI 20 SLAY-screened peptide P331 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCACTAATTTGCTGGTTATGTTCTCCTTTTTGGCCTGTATGTCTATCCCCATGCGCATTTAA RTNLLVMFSFLACMSIPMRI* -3.144 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21982 EHAS 4 SLAY-screened peptide P332 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGAGCACGCGAGCTAGACGTTCGATAATTCTCTTATCTATCCTCATCGTTGCATTTTTGATTAA EHAS*TFDNSLIYPHRCIFD* -3.144 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21983 YFPWKGIDY 9 SLAY-screened peptide P333 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATTTCCCTTGGAAGGGTATTGATTATTAGACTGACGTCGACATGGCGTATTAGATTGTTTAA YFPWKGIDY*TDVDMAY*IV* -3.135 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21984 CNQSPFIYIACWGNGVIVHL 20 SLAY-screened peptide P334 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCAACCAGTCTCCGTTCATTTACATCGCTTGTTGGGGTAATGGTGTTATTGTTCATCTTTAA CNQSPFIYIACWGNGVIVHL* -3.134 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21985 WIPPPQASDTTDGVASSKYD 20 SLAY-screened peptide P335 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGGATTCCGCCTCCGCAGGCTAGTGATACTACTGATGGCGTTGCTAGTTCTAAGTACGATTAA WIPPPQASDTTDGVASSKYD* -3.133 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21986 HLDLHLNKSLHITLWYV 17 SLAY-screened peptide P336 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATTTGGATTTGCACCTCAATAAGAGTCTCCATATTACTCTCTGGTACGTCTAGGGCTTAACT HLDLHLNKSLHITLWYV*GLT -3.133 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21987 VHTLQTYKDAALDTLYRVLFN 21 SLAY-screened peptide P337 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTGCATACGCTGCAGACGTACAAGGACGCCGCTCTTGATACTCTTTACAGGGTCCTGTTTAAC VHTLQTYKDAALDTLYRVLFN -3.132 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21988 AQAPDSRYDNTFIGHIDVMK 20 SLAY-screened peptide P338 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTCAGGCGCCTGATAGTCGCTATGATAATACTTTTATCGGTCACATTGACGTTATGAAGTAA AQAPDSRYDNTFIGHIDVMK* -3.127 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21989 RKSYSLHICANDYNDKNLGPN 21 SLAY-screened peptide P339 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGAAGAGCTACTCTCTTCACATTTGCGCGAATGATTATAACGATAAGAATCTTGGACCTAAC RKSYSLHICANDYNDKNLGPN -3.124 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21990 NKCRPISKADVL 12 SLAY-screened peptide P340 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATAAGTGCCGCCCCATCTCGAAGGCTGACGTGTTGTAGATGGTTGACTCTAACAGCACTTAA NKCRPISKADVL*MVDSNST* -3.124 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21991 AHPRPVSAP 9 SLAY-screened peptide P341 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTCATCCCCGTCCGGTGTCCGCTCCTTAGCACCATCACCCTTAGAACACGACCGTGCACTAA AHPRPVSAP*HHHP*NTTVH* -3.12 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21992 SSDYSDPLSWARSTCDNRNP 20 SLAY-screened peptide P342 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCGTCGGATTACAGTGATCCTCTTTCTTGGGCGCGGTCTACTTGCGACAATAGGAACCCTTAA SSDYSDPLSWARSTCDNRNP* -3.117 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21993 AFTNMLITAFCNPIYAMTVDL 21 SLAY-screened peptide P343 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGTTCACGAACATGCTTATTACGGCTTTTTGCAACCCTATCTATGCTATGACCGTCGACCTG AFTNMLITAFCNPIYAMTVDL -3.114 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21994 VCDYHYNIHCLRRR 14 SLAY-screened peptide P344 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTTTGTGATTACCATTATAACATCCATTGTCTTCGCCGTCGTTAGTAGCCTCATAATAATTAA VCDYHYNIHCLRRR**PHNN* -3.106 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21995 IIDSGTQPGAFYLVMFRIVQ 20 SLAY-screened peptide P345 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTATTGATAGTGGTACTCAGCCTGGTGCTTTTTACCTGGTTATGTTCCGTATTGTTCAGTAA IIDSGTQPGAFYLVMFRIVQ* -3.102 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21996 GTSSPRKPIHNYRKENITND 20 SLAY-screened peptide P346 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGTACTAGCTCTCCTCGTAAGCCCATTCATAACTACAGGAAGGAGAATATCACGAACGACTAA GTSSPRKPIHNYRKENITND* -3.101 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21997 VPFLPGIWVLPRPVRIASFAN 21 SLAY-screened peptide P347 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTGCCATTTTTGCCCGGTATATGGGTACTACCAAGACCTGTGCGCATCGCGTCGTTTGCTAAC VPFLPGIWVLPRPVRIASFAN -3.101 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21998 SGEDR 5 SLAY-screened peptide P348 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCGGGGAGGACCGGTAGCCTCTCTCTGTCCCTATTGTTCTTGACCCTGATCAGGCTTCGTAA SGEDR*PLSVPIVLDPDQAS* -3.1 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP21999 MPRVHPTVDRNALYLIPVIN 20 SLAY-screened peptide P349 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATGCCTCGTGTCCACCCTACGGTGGATCGTAACGCTCTTTATCTCATTCCCGTTATTAACTAA MPRVHPTVDRNALYLIPVIN* -3.091 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22000 APRIDDIR 8 SLAY-screened peptide P350 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTCCGCGCATTGATGACATTAGGTAGGGTCGCTCTAACAATATTGGGGCGCTGTTTTCGTAA APRIDDIR*GRSNNIGALFS* -3.09 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22001 AQSDWNTSVGSFHYSCAILY 20 SLAY-screened peptide P351 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTCAGAGTGATTGGAACACTTCGGTCGGTAGTTTCCATTATAGTTGTGCTATCTTGTACTAA AQSDWNTSVGSFHYSCAILY* -3.086 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22002 LPFRWGGSVRYPMRRCTTLV 20 SLAY-screened peptide P352 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGCCTTTTCGTTGGGGTGGGTCTGTGCGTTACCCTATGCGCCGTTGTACTACTCTCGTCTAA LPFRWGGSVRYPMRRCTTLV* -3.08 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22003 RAHSSHRYNHVVYSISSYIY 20 SLAY-screened peptide P353 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCGCTCATAGCTCGCATCGTTATAACCATGTTGTCTACTCTATTTCTAGTTATATTTATTAA RAHSSHRYNHVVYSISSYIY* -3.072 0.000049 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22004 AHRSGNFFPIYPSSLPMAFY 20 SLAY-screened peptide P354 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTCATCGTTCGGGGAATTTTTTTCCCATTTACCCTAGTTCTCTTCCTATGGCTTTTTACTAA AHRSGNFFPIYPSSLPMAFY* -3.071 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22005 IVGDLLNKGFNSGDSFT 17 SLAY-screened peptide P355 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTGTTGGCGACCTTCTTAATAAGGGGTTTAATTCGGGCGATAGCTTCACTTAGGCTAGTTAC IVGDLLNKGFNSGDSFT*ASY -3.066 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22006 PVNEDIQ 7 SLAY-screened peptide P356 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGGTCAACGAGGACATCCAGTAGACCCTTACGACAACCATTACCACATGAGTCTTAGCTAAC PVNEDIQ*TLTTTITT*VLAN -3.065 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22007 RENRPSHWFVTQLCYLLCRH 20 SLAY-screened peptide P357 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGTGAGAATAGGCCCAGCCATTGGTTTGTCACTCAGCTTTGCTATTTGCTTTGCCGCCACTAA RENRPSHWFVTQLCYLLCRH* -3.065 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22008 PATTNGSR 8 SLAY-screened peptide P358 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTGCGACTACTAATGGCTCTCGGTAGACGTGCGCTGACATTTGCAATTCCCTGGATTCGTAA PATTNGSR*TCADICNSLDS* -3.065 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22009 STLLKSYHIFAYSMLPFWYH 20 SLAY-screened peptide P359 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGTACTTTGCTTAAGTCCTATCATATCTTTGCGTACAGTATGTTGCCTTTTTGGTACCATTAA STLLKSYHIFAYSMLPFWYH* -3.064 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22010 GSKGSCTLYFNLIGFWTPTD 20 SLAY-screened peptide P360 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGTTCGAAGGGCTCTTGCACGCTGTACTTTAATCTTATCGGCTTTTGGACTCCGACGGACTAA GSKGSCTLYFNLIGFWTPTD* -3.063 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22011 RCHLHCYTTLNDPPHHRVS 19 SLAY-screened peptide P361 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCTGTCACCTTCACTGTTACACTACCTTGAACGACCCTCCCCACCATCGTGTCAGCTAGTAA RCHLHCYTTLNDPPHHRVS** -3.061 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22012 LPEISHTRR 9 SLAY-screened peptide P362 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTCCCGAGATCAGCCACACTCGTCGTTAGATCCCGAAGGAGCGCTGTCACCGTTACAATTAA LPEISHTRR*IPKERCHRYN* -3.059 0.000006 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22013 HTIVLLTLVTLRRRLYSFLK 20 SLAY-screened peptide P363 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATACCATCGTCTTGCTCACCCTCGTCACGCTCCGGCGCCGGCTCTATAGCTTCCTCAAGTAA HTIVLLTLVTLRRRLYSFLK* -3.058 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22014 AHLSNSIDPFHAGSVHFTPD 20 SLAY-screened peptide P364 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGCATCTTAGCAACAGTATTGATCCTTTCCATGCTGGCAGCGTCCACTTCACCCCTGACTAA AHLSNSIDPFHAGSVHFTPD* -3.056 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22015 LKWYCHFNSTQNLRAQTNIG 20 SLAY-screened peptide P365 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTAAGTGGTACTGTCATTTTAATAGTACCCAGAATCTGCGCGCCCAGACGAACATCGGCTAA LKWYCHFNSTQNLRAQTNIG* -3.055 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22016 CGGLLAWTGPLSECIQFWLL 20 SLAY-screened peptide P366 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCGGTGGCTTGCTGGCGTGGACCGGCCCGCTGAGCGAGTGCATTCAGTTCTGGCTTCTTTAA CGGLLAWTGPLSECIQFWLL* -3.052 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22017 PP 2 SLAY-screened peptide P367 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGCCGTAGCCGATCACGACGCATACGTAGTCGCCGAGTAATCTGCTGGCTGTGATGATGTAA PP*PITTHT*SPSNLLAVMM* -3.052 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22018 LRGLLSFSSYQMVMDGDTITN 21 SLAY-screened peptide P368 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTCGCGGCCTTCTTAGCTTCTCTTCCTATCAGATGGTTATGGACGGTGATACTATTACTAAC LRGLLSFSSYQMVMDGDTITN -3.052 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22019 TTLFNVSLHMVNTSGSTGTN 20 SLAY-screened peptide P369 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCACCCTGTTTAACGTTTCCTTGCATATGGTTAATACTAGCGGTTCTACTGGTACTAACTAA TTLFNVSLHMVNTSGSTGTN* -3.05 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22020 AGNWLMAGLSLAPARPSPNG 20 SLAY-screened peptide P370 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTGGCAACTGGCTTATGGCCGGTCTCAGCCTTGCTCCTGCGCGTCCTAGCCCTAATGGCTAA AGNWLMAGLSLAPARPSPNG* -3.048 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22021 LSLHCDIGFNANNTLSTDYI 20 SLAY-screened peptide P371 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGTCCTTGCATTGTGATATTGGTTTTAACGCCAATAATACGCTGTCCACCGATTACATTTAA LSLHCDIGFNANNTLSTDYI* -3.046 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22022 FLVAVRINFNLNIRFYIDLS 20 SLAY-screened peptide P372 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTTCTTGTCGCCGTGCGCATTAATTTTAACCTCAATATCCGCTTTTATATCGACCTCTCTTAA FLVAVRINFNLNIRFYIDLS* -3.042 0.000007 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22023 FIPHHNHSLAYETIVSGRDP 20 SLAY-screened peptide P373 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTCATTCCTCATCATAATCATAGCCTCGCTTACGAGACGATTGTTAGTGGGCGTGACCCGTAA FIPHHNHSLAYETIVSGRDP* -3.038 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22024 HHRSRKMYNWNHNEANRHYQ 20 SLAY-screened peptide P374 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACACCATAGGAGTCGCAAGATGTATAACTGGAACCATAACGAGGCTAACCGTCACTATCAGTAA HHRSRKMYNWNHNEANRHYQ* -3.036 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22025 IICLELANDDLCCKCHSSDD 20 SLAY-screened peptide P375 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTATTTGCCTGGAGCTGGCTAATGATGATCTCTGTTGCAAGTGTCATTCTTCCGACGACTAA IICLELANDDLCCKCHSSDD* -3.035 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22026 LAESALLRGNNSCNLTFIRN 20 SLAY-screened peptide P376 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCGCCGAGAGCGCTCTGTTGCGTGGCAATAATAGTTGTAATTTGACTTTTATCAGGAACTAA LAESALLRGNNSCNLTFIRN* -3.035 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22027 YSHVCKTNTSHCYTFHYNGF 20 SLAY-screened peptide P377 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATACTCTCACGTTTGTAAGACTAATACTTCCCATTGTTATACTTTTCATTACAATGGCTTCTAA YSHVCKTNTSHCYTFHYNGF* -3.033 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22028 SQP 3 SLAY-screened peptide P378 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGTCAGCCTTAGCTGATCCCCATTACTAACTAGCATTCTAGTTCGTTCATGCCCGCCGACTAA SQP*LIPITN*HSSSFMPAD* -3.022 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22029 KHRF 4 SLAY-screened peptide P379 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAAGCATCGCTTTTAGCATGCTTATGCGCCGTGGTACGCTTTTAACTTTGTCTGTCGCTATTAA KHRF*HAYAPWYAFNFVCRY* -3.018 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22030 LCALTQASTLSNNHTTHLAT 20 SLAY-screened peptide P380 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCTGCGCCCTCACTCAGGCCTCTACTCTTAGTAACAACCATACTACGCATTTGGCTACGTAA LCALTQASTLSNNHTTHLAT* -3.012 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22031 WFAPCKSAAIHAF 13 SLAY-screened peptide P381 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGGTTTGCCCCCTGCAAGAGTGCCGCCATCCATGCTTTTTAGCTTCTCAACCATGAGGCTTAA WFAPCKSAAIHAF*LLNHEA* -3.01 0.000101 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22032 PRTLLTTALRILYTKGLLGD 20 SLAY-screened peptide P382 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTCGCACTTTGCTTACTACTGCGCTTCGCATTCTTTATACTAAGGGGCTTCTTGGCGACTAA PRTLLTTALRILYTKGLLGD* -3.008 0.000002 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22033 VFSSAYRADAKGTSSFNSTQ 20 SLAY-screened peptide P383 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTCTTCTCGTCGGCGTATCGTGCTGACGCTAAGGGCACGTCGAGTTTCAACTCGACGCAGTAA VFSSAYRADAKGTSSFNSTQ* -3.008 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22034 PNISTGPSFILPLLLGCIAFN 21 SLAY-screened peptide P384 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTAACATTTCTACCGGTCCAAGTTTTATACTACCCCTTCTCCTGGGTTGCATCGCATTTAAC PNISTGPSFILPLLLGCIAFN -3.008 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22035 YSTSSCSCDYQSSSYR 16 SLAY-screened peptide P385 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATAGTACTTCGAGTTGTTCTTGTGATTACCAATCGTCATCTTATCGGTAACTGAGTAAGTCG YSTSSCSCDYQSSSYR*LSKS -3.006 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22036 HAALGCQHYPNMRTELDHTK 20 SLAY-screened peptide P386 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATGCGGCCCTCGGTTGTCAGCATTATCCGAACATGCGGACTGAGCTCGATCACACTAAGTAA HAALGCQHYPNMRTELDHTK* -3.005 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22037 ASSVSSFVLYSARSFNNSSH 20 SLAY-screened peptide P387 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTAGTTCTGTGTCCAGTTTTGTGCTCTATTCTGCTCGTTCTTTCAATAATAGTTCTCATTAA ASSVSSFVLYSARSFNNSSH* -3.004 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22038 VALDTTFSHRSPP 13 SLAY-screened peptide P388 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTCGCGCTTGACACTACTTTTAGTCATCGGAGTCCCCCTTAGACCTTTTATATTAAGAATTAA VALDTTFSHRSPP*TFYIKN* -3.002 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22039 LVYTDLYGFFSDLRPRNQDD 20 SLAY-screened peptide P389 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTGGTGTACACTGACCTTTACGGTTTTTTTAGCGACCTTCGCCCTAGGAACCAGGACGATTAA LVYTDLYGFFSDLRPRNQDD* -3.001 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22040 KNVNHSVIVNPNFDPNTVTR 20 SLAY-screened peptide P390 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAAGAATGTTAATCATAGTGTCATCGTCAACCCGAATTTCGATCCGAATACTGTTACGAGGTAA KNVNHSVIVNPNFDPNTVTR* -2.997 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22041 STTLYLPGLNRIRTNDFMIT 20 SLAY-screened peptide P391 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCGACCACTCTGTATCTGCCTGGTCTTAACCGGATCAGGACGAACGATTTTATGATCACCTAA STTLYLPGLNRIRTNDFMIT* -2.995 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22042 STLINVFDR 9 SLAY-screened peptide P392 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTACCCTCATTAACGTTTTCGACAGGTAGGTGTATAAGTCGTGGCCGATTTACTGGTCCTAA STLINVFDR*VYKSWPIYWS* -2.993 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22043 LVTDAMWHGLHVSRCHSHYY 20 SLAY-screened peptide P393 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCGTTACTGATGCCATGTGGCATGGGCTTCATGTTTCGCGTTGTCATAGTCACTACTACTAA LVTDAMWHGLHVSRCHSHYY* -2.988 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22044 GPIHDVLRMIRSSGTTHFYS 20 SLAY-screened peptide P394 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGCCCTATCCATGATGTGCTTAGGATGATTCGTAGCTCCGGGACGACCCACTTTTATAGCTAA GPIHDVLRMIRSSGTTHFYS* -2.986 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22045 LPTNSIRRDGLSADHHRYIRN 21 SLAY-screened peptide P395 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCCCCACTAATAGTATTCGTCGTGACGGCCTCAGCGCTGATCATCATCGCTACATCCGTAAC LPTNSIRRDGLSADHHRYIRN -2.985 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22046 LMRSVFLNMCIPSDYMDPSVP 21 SLAY-screened peptide P396 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCATGCGTAGTGTCTTTCTTAATATGTGCATCCCTTCTGACTATATGGACCCCAGTGTGCCC LMRSVFLNMCIPSDYMDPSVP -2.98 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22047 NKNPIRLSFYPHNYYLYSSV 20 SLAY-screened peptide P397 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATAAGAATCCCATCAGGCTTAGTTTCTATCCTCATAATTATTATTTGTATTCCAGTGTTTAA NKNPIRLSFYPHNYYLYSSV* -2.977 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22048 TSLCFVIILNLKSDMAG 17 SLAY-screened peptide P398 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTTCTCTGTGCTTCGTCATTATTCTTAATCTCAAGAGTGATATGGCGGGCTAGTGTTCGTAA TSLCFVIILNLKSDMAG*CS* -2.975 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22049 HNNPPAPNGPHSTFIADNAS 20 SLAY-screened peptide P399 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATAACAATCCGCCGGCCCCTAACGGGCCTCATAGTACGTTTATCGCTGATAATGCTAGTTAA HNNPPAPNGPHSTFIADNAS* -2.97 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22050 WTYFHSNPHEYQLNLLIANM 20 SLAY-screened peptide P400 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGGACCTACTTTCATAGTAACCCGCATGAGTATCAGCTTAACCTTCTTATTGCCAATATGTAA WTYFHSNPHEYQLNLLIANM* -2.966 0.000063 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22051 LIFTLQNRLQPVAMHKPCYS 20 SLAY-screened peptide P401 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTATCTTTACCTTGCAGAACCGCCTCCAGCCGGTGGCCATGCATAAGCCCTGTTACTCCTAA LIFTLQNRLQPVAMHKPCYS* -2.962 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22052 PDHNNHT 7 SLAY-screened peptide P402 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGGATCACAATAATCATACGTAGTTCATGTTTAGTACCACTACGTTGTACCATGAGCCGTAA PDHNNHT*FMFSTTTLYHEP* -2.96 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22053 YHNHSHD 7 SLAY-screened peptide P403 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATACCATAATCACTCTCATGATTAGGATGCCGCCCTGTACCTTGGTTCCATGTAGATGATCTAA YHNHSHD*DAALYLGSM*MI* -2.958 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22054 ALTQHRLGLRNIPQNLYIMV 20 SLAY-screened peptide P404 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGCTCACTCAGCATCGTCTCGGGCTTAGGAATATCCCTCAGAATCTCTATATTATGGTCTAA ALTQHRLGLRNIPQNLYIMV* -2.955 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22055 ASFTHPPIMAPPIYASSEVE 20 SLAY-screened peptide P405 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGTCTTTTACTCATCCTCCTATCATGGCCCCGCCTATCTACGCTTCTAGTGAGGTTGAGTAA ASFTHPPIMAPPIYASSEVE* -2.955 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22056 HTLQQLRCPHCSLSNNSMVY 20 SLAY-screened peptide P406 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACACACTCTTCAGCAGCTTCGTTGTCCGCATTGCAGCCTTAGCAATAATTCTATGGTGTACTAA HTLQQLRCPHCSLSNNSMVY* -2.951 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22057 TISRGNSPPSANTALLMNYI 20 SLAY-screened peptide P407 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGATTTCTCGCGGTAATTCGCCTCCTTCTGCTAATACTGCGCTTCTCATGAACTACATTTAA TISRGNSPPSANTALLMNYI* -2.948 0.000005 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22058 TSPMQSLRLLTSISLKNRVM 20 SLAY-screened peptide P408 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCTCTCCTATGCAGTCCCTGCGTCTCCTCACGAGCATCTCGTTGAAGAACAGGGTTATGTAA TSPMQSLRLLTSISLKNRVM* -2.945 0.000004 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22059 IAVGPVGRIRFPRLTFRFTL 20 SLAY-screened peptide P409 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTGCCGTGGGCCCTGTGGGCCGCATCCGTTTTCCTAGGCTCACTTTTCGCTTTACCCTGTAA IAVGPVGRIRFPRLTFRFTL* -2.944 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22060 SGRQTGNHNCYMSLQLLTIC 20 SLAY-screened peptide P410 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTGGCCGTCAGACGGGGAACCATAATTGTTATATGTCTCTTCAGCTCCTGACCATCTGCTAA SGRQTGNHNCYMSLQLLTIC* -2.939 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22061 QSAAGMPSVD 10 SLAY-screened peptide P411 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGTCCGCCGCTGGTATGCCTAGCGTTGATTAGGTGTTGTATCCTCATGTGCGTTCCGTTTAA QSAAGMPSVD*VLYPHVRSV* -2.937 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22062 PRIFCILLPRPCSGHVFYAS 20 SLAY-screened peptide P412 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCCGGATTTTCTGTATTTTGCTTCCTCGGCCCTGTTCTGGCCACGTGTTCTATGCTAGTTAA PRIFCILLPRPCSGHVFYAS* -2.927 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22063 VSFFTVPLWHCLPSDLLALN 20 SLAY-screened peptide P413 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTCTCTTTTTTTACCGTGCCGCTGTGGCATTGTCTGCCGAGTGATCTTTTGGCGCTGAATTAA VSFFTVPLWHCLPSDLLALN* -2.919 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22064 ALRTMY 6 SLAY-screened peptide P414 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCCTTCGCACTATGTATTAGTTTTACAATTATATCTTACCTGTAAGAACAATAGGAATTAAC ALRTMY*FYNYILPVRTIGIN -2.911 0.000044 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22065 RTLPFCAPGIVLTLI 15 SLAY-screened peptide P415 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGAACGTTACCATTTTGCGCACCGGGAATAGTTCTTACACTTATATGACCATCTTGTTCTAAC RTLPFCAPGIVLTLI*PSCSN -2.911 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22066 CVVDPLY 7 SLAY-screened peptide P416 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCGTCGTGGACCCTCTCTATTAGTATTGGGCCATCCTCTCCTTTTGCCGTAGGTACCCTTAA CVVDPLY*YWAILSFCRRYP* -2.903 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22067 RPIIPYSAHSYLCVTTYNPT 20 SLAY-screened peptide P417 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGCCCATTATTCCTTATAGCGCTCACTCTTATCTGTGTGTCACCACCTACAATCCTACGTAA RPIIPYSAHSYLCVTTYNPT* -2.902 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22068 LRVPIVPISS 10 SLAY-screened peptide P418 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTCGTGTGCCCATTGTTCCTATTTCGAGTTAGTGTCAGAACGTCTTCAATGGCGACTCTTAA LRVPIVPISS*CQNVFNGDS* -2.901 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22069 YRHTAN 6 SLAY-screened peptide P419 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATAGGCACACTGCTAACTAGCTCCGTGAGTATCTTGGGTAGGCGACGCTGGAGAGTGCTTAA YRHTAN*LREYLG*ATLESA* -2.899 0.000009 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22070 RAN 3 SLAY-screened peptide P420 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGGCGAATTAGCACCTCCCTCATGAGACTCATGATACGGTTGAGTCGTCCATGAATAGCTAA RAN*HLPHETHDTVESSMNS* -2.892 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22071 MLDYFLGHSYLSLVDEDPNR 20 SLAY-screened peptide P421 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATGTTGGACTACTTTCTCGGTCACAGTTATCTCAGCCTCGTTGATGAGGATCCTAACAGGTAA MLDYFLGHSYLSLVDEDPNR* -2.888 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22072 APLFFGLCIVCTTDGRRKSF 20 SLAY-screened peptide P422 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCCCCTTGTTTTTTGGCCTTTGTATCGTCTGTACTACGGATGGTCGCCGGAAGAGCTTTTAA APLFFGLCIVCTTDGRRKSF* -2.885 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22073 TCVDITATICAVTWIVIDFA 20 SLAY-screened peptide P423 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTTGTGTTGATATTACTGCGACTATTTGTGCTGTTACGTGGATTGTGATTGATTTTGCCTAA TCVDITATICAVTWIVIDFA* -2.884 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22074 NLL 3 SLAY-screened peptide P424 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACCTGCTGTAGCTTTATTAGAATTCGGTTCAGAGCCTTGTTACGGGTTGCCATTGGTTTTAA NLL*LY*NSVQSLVTGCHWF* -2.884 0.000004 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22075 DWTYTYVSRPIASLADLHAI 20 SLAY-screened peptide P425 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATTGGACCTACACTTATGTGTCCCGGCCTATTGCTTCTCTTGCTGACCTCCATGCGATCTAA DWTYTYVSRPIASLADLHAI* -2.879 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22076 MAGSVAYTSSFSNPCTVNHY 20 SLAY-screened peptide P426 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATGGCCGGTTCCGTTGCCTATACTTCGTCGTTCTCTAACCCTTGTACTGTCAATCATTATTAA MAGSVAYTSSFSNPCTVNHY* -2.876 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22077 LIFIVLSHSTPHARGPPGRA 20 SLAY-screened peptide P427 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTGATTTTTATCGTGCTTTCCCATAGTACGCCGCACGCGAGGGGCCCCCCGGGGCGTGCCTAA LIFIVLSHSTPHARGPPGRA* -2.876 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22078 LLFAFPVPGNVPEVLAENTP 20 SLAY-screened peptide P428 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGCTTTTTGCTTTCCCTGTCCCTGGTAATGTCCCTGAGGTTCTTGCTGAGAACACTCCCTAA LLFAFPVPGNVPEVLAENTP* -2.867 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22079 DIVSLSRRIPFERTFDPK 18 SLAY-screened peptide P429 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATATTGTGTCCTTGTCGCGTAGGATCCCCTTTGAGCGCACGTTTGACCCCAAGTAGAAGTAA DIVSLSRRIPFERTFDPK*K* -2.866 0.000048 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22080 NFHDETIKLLSPNLYALAIS 20 SLAY-screened peptide P430 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACTTCCACGATGAGACTATTAAGTTGCTTAGTCCTAATCTCTACGCGCTGGCTATTAGTTAA NFHDETIKLLSPNLYALAIS* -2.864 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22081 PAVGNYSYVFINSLTAGFLV 20 SLAY-screened peptide P431 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCGCCGTGGGCAACTATTCTTACGTGTTCATTAACAGCCTTACTGCGGGTTTTCTGGTGTAA PAVGNYSYVFINSLTAGFLV* -2.862 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22082 SRITANNSHIITRETKLCYW 20 SLAY-screened peptide P432 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCGCGGATTACCGCTAATAATAGCCATATTATTACCCGTGAGACCAAGTTGTGCTACTGGTAA SRITANNSHIITRETKLCYW* -2.862 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22083 HGHASDYIDPHGAQC 15 SLAY-screened peptide P433 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATGGGCATGCGTCCGATTACATTGACCCGCATGGGGCCCAGTGTTAGACCAGGTGCCACTAA HGHASDYIDPHGAQC*TRCH* -2.856 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22084 CNSYPVYDHHSHTAYDQFQ 19 SLAY-screened peptide P434 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGTAATAGTTACCCTGTGTATGATCATCACAGTCACACGGCTTATGATCAGTTTCAGTAGTAA CNSYPVYDHHSHTAYDQFQ** -2.855 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22085 YGGYSIRFSHYYIYMSSPHL 20 SLAY-screened peptide P435 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATACGGCGGGTATTCTATCAGGTTCTCCCATTATTATATTTACATGTCCAGTCCGCATTTGTAA YGGYSIRFSHYYIYMSSPHL* -2.854 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22086 CID 3 SLAY-screened peptide P436 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCATTGATTAGTCTAGCGCTCTGCTGCGGCCGAGTATGTAGATGCAGGTTTCTCCCGTTTAA CID*SSALLRPSM*MQVSPV* -2.852 0.000007 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22087 PSAAVGLIPFLMARANYYLT 20 SLAY-screened peptide P437 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTAGTGCGGCCGTCGGCCTGATCCCCTTTCTTATGGCTAGGGCGAACTACTATCTGACGTAA PSAAVGLIPFLMARANYYLT* -2.851 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22088 TLETRFYLFYTLDTMMSKHN 20 SLAY-screened peptide P438 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGCTGGAGACTCGCTTTTACCTTTTTTATACTCTTGACACGATGATGTCGAAGCACAACTAA TLETRFYLFYTLDTMMSKHN* -2.851 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22089 CRNCVYHHYNISPNASPASD 20 SLAY-screened peptide P439 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCAGGAACTGCGTTTATCACCATTACAATATTAGCCCTAATGCCTCGCCTGCTTCCGATTAA CRNCVYHHYNISPNASPASD* -2.849 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22090 DHPSTCHHGVGPCLFLNYNI 20 SLAY-screened peptide P440 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATCACCCTAGTACCTGTCATCATGGCGTTGGCCCGTGCCTCTTTCTCAATTACAATATCTAA DHPSTCHHGVGPCLFLNYNI* -2.846 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22091 IDHCIVGVRNSLARVLANGF 20 SLAY-screened peptide P441 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATCGATCATTGTATTGTGGGCGTTCGCAATAGCTTGGCGAGGGTTCTCGCGAACGGGTTTTAA IDHCIVGVRNSLARVLANGF* -2.842 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22092 SYNGPSDSPHTHSRHCSFQR 20 SLAY-screened peptide P442 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTTATAATGGTCCTTCCGATTCTCCCCATACTCATTCTCGGCATTGTTCGTTCCAGCGCTAA SYNGPSDSPHTHSRHCSFQR* -2.84 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22093 YIGVPGLASRYVLSVLLHGV 20 SLAY-screened peptide P443 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATATCGGTGTTCCGGGTCTGGCCTCCCGTTACGTTCTTTCTGTCTTGCTTCACGGTGTCTAA YIGVPGLASRYVLSVLLHGV* -2.839 0.000025 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22094 VEHPISLRFFFGVRSVCVIN 20 SLAY-screened peptide P444 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTCGAGCACCCTATTAGCCTGCGCTTTTTTTTCGGTGTGCGCAGCGTTTGCGTTATTAATTAA VEHPISLRFFFGVRSVCVIN* -2.839 0.000012 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22095 WLPPHRDPRL 10 SLAY-screened peptide P445 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGGCTGCCCCCGCATCGCGACCCCAGGCTTTAGTCCTCCCTGCCTGCTCAGCCGGACGTCTAA WLPPHRDPRL*SSLPAQPDV* -2.839 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22096 EILLLIRIGILILWIMISLGN 21 SLAY-screened peptide P446 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGAGATACTTCTTCTCATACGCATAGGCATACTAATTTTGTGGATAATGATCTCACTGGGTAAC EILLLIRIGILILWIMISLGN -2.836 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22097 YFTHPHIYAVSPTVTQFFIA 20 SLAY-screened peptide P447 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATACTTCACTCATCCTCATATTTATGCTGTGTCTCCCACTGTCACCCAGTTTTTTATTGCCTAA YFTHPHIYAVSPTVTQFFIA* -2.835 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22098 FTQAREAPCTPDMSSDH 17 SLAY-screened peptide P448 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTTACCCAGGCGCGCGAGGCGCCCTGCACCCCCGACATGTCTAGTGATCATTAGTTTCGCTAA FTQAREAPCTPDMSSDH*FR* -2.834 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22099 CPTVLDYHSRDSTTTFSLEP 20 SLAY-screened peptide P449 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCCCGACTGTGCTTGACTACCATTCGCGCGATTCTACTACTACGTTTTCGCTCGAGCCCTAA CPTVLDYHSRDSTTTFSLEP* -2.832 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22100 FTPTCCVTRLHTSAQLRVRH 20 SLAY-screened peptide P450 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTTACCCCGACTTGCTGCGTCACTCGCCTGCATACTAGCGCTCAGCTTCGCGTTAGGCATTAA FTPTCCVTRLHTSAQLRVRH* -2.831 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22101 RPNWNIRSCIQCEFQIQ 17 SLAY-screened peptide P451 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGGCCGAATTGGAATATCAGGAGTTGCATCCAGTGCGAGTTTCAGATTCAGTAGTATATGTAA RPNWNIRSCIQCEFQIQ*YM* -2.831 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22102 TAPRVAAPHTLHCNRWWLTP 20 SLAY-screened peptide P452 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGGCGCCCCGGGTCGCCGCCCCGCATACGCTTCACTGTAATCGTTGGTGGCTCACCCCTTAA TAPRVAAPHTLHCNRWWLTP* -2.829 0.000001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22103 DLYHSYHDCHHNTA 14 SLAY-screened peptide P453 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGACCTCTATCATAGTTATCACGATTGCCATCATAATACTGCTTAGTTTATGAACACCTATTAA DLYHSYHDCHHNTA*FMNTY* -2.828 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22104 TPRDVDADLGPVATPRTIFM 20 SLAY-screened peptide P454 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTCCCCGCGATGTGGATGCTGATCTGGGTCCTGTCGCCACTCCCCGTACCATCTTTATGTAA TPRDVDADLGPVATPRTIFM* -2.826 0.000023 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22105 LSSNDRPAKYKDSDCGHSYL 20 SLAY-screened peptide P455 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCAGCAGCAACGATCGCCCCGCCAAGTACAAGGATAGTGACTGCGGTCATTCCTATTTGTAA LSSNDRPAKYKDSDCGHSYL* -2.826 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22106 TNGHDRKKDTFSCPFISNRH 20 SLAY-screened peptide P456 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTAACGGGCACGACCGTAAGAAGGATACGTTTTCGTGTCCTTTTATCAGTAACCGTCATTAA TNGHDRKKDTFSCPFISNRH* -2.825 0.000004 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22107 NSPFFQNNRYIHAAFDSDLT 20 SLAY-screened peptide P457 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACAGCCCGTTTTTTCAGAATAACCGCTACATTCACGCGGCTTTCGATAGCGACCTCACTTAA NSPFFQNNRYIHAAFDSDLT* -2.824 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22108 SSFRETYYYIPALYFVWGTR 20 SLAY-screened peptide P458 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCTCTTTCCGGGAGACTTACTATTATATTCCCGCTCTGTACTTTGTTTGGGGTACGCGCTAA SSFRETYYYIPALYFVWGTR* -2.823 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22109 LYVSIILLVGRITFCMTILSN 21 SLAY-screened peptide P459 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTTACGTTTCTATCATCTTGCTTGTCGGTCGAATAACCTTCTGCATGACCATACTGTCTAAC LYVSIILLVGRITFCMTILSN -2.819 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22110 FHQKVSGILNRDSINHFDSA 20 SLAY-screened peptide P460 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTTCATCAGAAGGTGTCCGGGATCCTTAACCGTGATTCTATTAATCATTTCGATTCTGCTTAA FHQKVSGILNRDSINHFDSA* -2.818 0.000011 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22111 VLSNARSGTFATHGYLLVRY 20 SLAY-screened peptide P461 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTCCTTAGCAATGCTAGGTCTGGGACTTTTGCTACGCATGGGTACCTTCTTGTGCGCTATTAA VLSNARSGTFATHGYLLVRY* -2.818 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22112 AMSHLLHRQYPHIRSNDPDA 20 SLAY-screened peptide P462 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCATGTCGCATCTCCTTCATCGCCAGTATCCTCATATCCGGAGTAATGATCCGGATGCTTAA AMSHLLHRQYPHIRSNDPDA* -2.814 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22113 YGYCCESPGFQPFGRANGSE 20 SLAY-screened peptide P463 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATGGTTACTGTTGCGAGTCCCCGGGGTTCCAGCCTTTCGGCCGCGCTAACGGCTCTGAGTAA YGYCCESPGFQPFGRANGSE* -2.812 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22114 DFVNRLRRFLCNRMHPNAAH 20 SLAY-screened peptide P464 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATTTCGTCAATCGGCTGCGTCGGTTTTTGTGCAACCGGATGCACCCCAATGCCGCCCATTAA DFVNRLRRFLCNRMHPNAAH* -2.811 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22115 YLHRPLFSCDLMYVV 15 SLAY-screened peptide P465 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATCTTCACCGGCCGCTGTTCTCGTGCGATCTTATGTATGTTGTTTAGCCTTCTCTGCACTAA YLHRPLFSCDLMYVV*PSLH* -2.798 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22116 YMHCSHPCPDLYR 13 SLAY-screened peptide P466 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATATGCATTGTTCTCATCCTTGTCCGGATCTTTACAGGTGACCCTCAATAATATTTGGTAAC YMHCSHPCPDLYR*PSIIFGN -2.798 0.000007 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22117 TLFTSNQCPYYHHSSTCYRS 20 SLAY-screened peptide P467 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCCTTTTTACCTCGAATCAGTGTCCGTATTACCATCACAGTAGTACCTGCTACAGGTCCTAA TLFTSNQCPYYHHSSTCYRS* -2.797 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22118 CPNISTNCRDTDIKKELSTRN 21 SLAY-screened peptide P468 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCCCTAATATTAGTACTAATTGTCGCGATACTGACATTAAGAAGGAACTTTCGACACGTAAC CPNISTNCRDTDIKKELSTRN -2.796 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22119 TQNYLSDT 8 SLAY-screened peptide P469 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCCAGAATTATTTGTCCGATACGTAGAACCGCCCTATCGCGTTCGCTCGCGGTAATCTGTAA TQNYLSDT*NRPIAFARGNL* -2.795 0.00001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22120 ARHVFRTNIVLLDIDYSNMS 20 SLAY-screened peptide P470 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCCGCCATGTTTTTCGGACTAATATTGTTCTTCTTGATATTGACTATAGCAATATGTCCTAA ARHVFRTNIVLLDIDYSNMS* -2.792 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22121 VVHLVGFTNNRHRDDL 16 SLAY-screened peptide P471 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTCGTCCACCTGGTTGGGTTTACTAATAACCGTCATCGGGATGATCTCTAGCACCGCTATTAA VVHLVGFTNNRHRDDL*HRY* -2.791 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22122 RDFSWGTPRYWNHMYYNNIL 20 SLAY-screened peptide P472 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGTGATTTTAGCTGGGGCACTCCGAGGTACTGGAATCATATGTACTATAATAATATCCTTTAA RDFSWGTPRYWNHMYYNNIL* -2.791 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22123 GNRVPATVCPIAISIPLMVD 20 SLAY-screened peptide P473 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGTAACCGCGTTCCTGCGACGGTCTGCCCTATTGCTATTTCGATCCCCCTTATGGTCGACTAA GNRVPATVCPIAISIPLMVD* -2.788 0.000007 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22124 CPSPKCAIVYQTIGPALPRA 20 SLAY-screened peptide P474 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCCCTAGTCCTAAGTGTGCTATTGTTTACCAGACTATCGGCCCTGCGCTCCCTCGGGCCTAA CPSPKCAIVYQTIGPALPRA* -2.785 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22125 KR 2 SLAY-screened peptide P475 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAAGCGCTAGACTCGTACTGGTCGTTTCATCATCGATCACACTAAGCAGAAGGATAGGTACTAA KR*TRTGRFIIDHTKQKDRY* -2.785 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22126 ITNIVTMQGAHSGFHRDTRT 20 SLAY-screened peptide P476 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATCACTAATATTGTTACTATGCAGGGTGCTCACAGTGGGTTCCACCGCGACACGAGGACGTAA ITNIVTMQGAHSGFHRDTRT* -2.783 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22127 GTTSNCDIYANIYTTDLYCG 20 SLAY-screened peptide P477 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGCACTACTAGCAATTGTGACATCTACGCGAACATTTACACTACTGACCTTTACTGCGGTTAA GTTSNCDIYANIYTTDLYCG* -2.78 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22128 YQSPSHGYGFPLMNPCYILA 20 SLAY-screened peptide P478 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATACCAGTCTCCTTCGCATGGTTATGGCTTCCCTTTGATGAACCCTTGCTATATTCTGGCCTAA YQSPSHGYGFPLMNPCYILA* -2.775 0.000002 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22129 STILSTTI 8 SLAY-screened peptide P479 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTACCATCTTGAGTACTACTATCTAGGCCTCTGCGATTGATTGGACGACGCTCTATCTTTAA STILSTTI*ASAIDWTTLYL* -2.77 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22130 DFLRCLTDLNKDITTLQSLD 20 SLAY-screened peptide P480 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATTTCCTCCGTTGCCTCACTGATCTTAACAAGGATATTACTACGCTTCAGAGTCTCGACTAA DFLRCLTDLNKDITTLQSLD* -2.769 0.000005 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22131 CSYLGFGKFFYL 12 SLAY-screened peptide P481 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGTTCTTATCTCGGCTTTGGCAAGTTTTTCTATCTCTAGAAGCCTTACCTCTTGCGTGAGTAA CSYLGFGKFFYL*KPYLLRE* -2.763 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22132 ASIHSSGKRPTFTAHRMLVE 20 SLAY-screened peptide P482 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGTCCATTCACAGTTCGGGGAAGCGTCCGACTTTCACCGCTCACAGGATGTTGGTGGAGTAA ASIHSSGKRPTFTAHRMLVE* -2.76 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22133 RQPDWAVLGSVQCPSPNRPF 20 SLAY-screened peptide P483 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGCAGCCGGATTGGGCGGTCCTCGGCTCTGTCCAGTGTCCGTCTCCTAATCGTCCTTTTTAA RQPDWAVLGSVQCPSPNRPF* -2.757 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22134 IPTPF 5 SLAY-screened peptide P484 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATACCGACTCCATTTTGAAGAATCTGTGTGACTTCTACAAGCGGACTCTCACCCACTATTAAC IPTPF*RICVTSTSGLSPTIN -2.754 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22135 LEPDFPWCGYNCGNRRRHHS 20 SLAY-screened peptide P485 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTGAGCCGGACTTCCCCTGGTGTGGCTACAACTGTGGTAACCGTAGGCGGCATCATTCTTAA LEPDFPWCGYNCGNRRRHHS* -2.753 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22136 TAPITLIRGPPSGHGYSACH 20 SLAY-screened peptide P486 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCGCCCCTATCACTCTCATCCGCGGCCCGCCGAGCGGGCATGGTTACAGTGCGTGTCATTAA TAPITLIRGPPSGHGYSACH* -2.752 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22137 SPIIKLYNEDVAHYDDLNI 19 SLAY-screened peptide P487 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGTCCGATTATTAAGCTCTACAATGAGGATGTTGCTCATTATGACGACCTTAACATCTAGTAA SPIIKLYNEDVAHYDDLNI** -2.751 0.000032 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22138 PPLFSGSGCNNHADYRSTSS 20 SLAY-screened peptide P488 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCCCTCTTTTTAGCGGTTCTGGTTGCAATAACCATGCTGACTATCGGTCCACTAGTTCCTAA PPLFSGSGCNNHADYRSTSS* -2.749 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22139 TDSMDFRSFDDAVGDIVYSA 20 SLAY-screened peptide P489 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGGATAGTATGGACTTCCGTAGCTTTGACGACGCCGTCGGGGATATCGTTTACTCTGCGTAA TDSMDFRSFDDAVGDIVYSA* -2.748 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22140 PATATGRCIGPVPYSTSDNL 20 SLAY-screened peptide P490 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGGCGACTGCCACGGGGCGCTGTATCGGCCCCGTGCCTTATTCTACCTCCGACAATCTTTAA PATATGRCIGPVPYSTSDNL* -2.747 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22141 DIPNLRVYYYDRHFTLIYMK 20 SLAY-screened peptide P491 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATATCCCTAACTTGCGCGTCTACTATTACGACCGTCACTTTACGCTTATTTATATGAAGTAA DIPNLRVYYYDRHFTLIYMK* -2.745 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22142 RNNNNSHAIHCSNTRDLGAC 20 SLAY-screened peptide P492 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCAATAACAATAACAGCCATGCTATCCATTGTAGCAATACGAGGGATTTGGGTGCCTGTTAA RNNNNSHAIHCSNTRDLGAC* -2.744 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22143 GLVIRTGGTLTFSSIIPTTK 20 SLAY-screened peptide P493 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGTCTGGTCATTCGTACTGGCGGTACGCTCACTTTTAGTAGTATCATCCCTACGACCAAGTAA GLVIRTGGTLTFSSIIPTTK* -2.744 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22144 HPSTWTMFTIDKSTLSFWTT 20 SLAY-screened peptide P494 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACACCCTAGTACTTGGACTATGTTTACTATTGACAAGAGCACGCTCTCCTTCTGGACCACTTAA HPSTWTMFTIDKSTLSFWTT* -2.741 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22145 TRSTLLCCRSILML 14 SLAY-screened peptide P495 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTCGATCAACATTGCTTTGCTGCCGTTCTATATTAATGCTTTGAGAAGCGGTTTCATTAACT TRSTLLCCRSILML*EAVSLT -2.74 0.000062 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22146 HCSTRLITLATPPTSQFFNS 20 SLAY-screened peptide P496 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATTGTAGTACGCGTCTCATCACTCTTGCTACCCCTCCTACGTCTCAGTTTTTTAATAGTTAA HCSTRLITLATPPTSQFFNS* -2.734 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22147 LRVSEESGSSCRIAGILRGMS 21 SLAY-screened peptide P497 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGCGGGTATCGGAGGAGAGCGGTTCTTCCTGTCGTATTGCGGGTATACTTCGCGGGATGTCT LRVSEESGSSCRIAGILRGMS -2.732 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22148 FSLYIRTYTNYKTNIILYII 20 SLAY-screened peptide P498 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTTTCGCTGTATATCCGCACTTATACTAACTATAAGACTAATATTATTCTCTATATCATTTAA FSLYIRTYTNYKTNIILYII* -2.732 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22149 VPMGCSPAPWYNHFGKRSYM 20 SLAY-screened peptide P499 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTGCCTATGGGCTGTAGCCCTGCTCCTTGGTACAATCATTTCGGTAAGCGCAGCTATATGTAA VPMGCSPAPWYNHFGKRSYM* -2.731 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22150 RPCFTSVFNSPFFFHNTQQF 20 SLAY-screened peptide P500 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGGCCTTGCTTCACTTCGGTCTTTAACAGCCCTTTTTTTTTTCATAACACGCAGCAGTTCTAA RPCFTSVFNSPFFFHNTQQF* -2.731 0.000017 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22151 CPSARCYFCRSVNITDCNTH 20 SLAY-screened peptide P501 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGTCCTAGTGCTCGTTGTTACTTCTGTCGTAGTGTTAATATTACGGATTGTAATACTCACTAA CPSARCYFCRSVNITDCNTH* -2.73 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22152 HPHPITFDFRRPHTLVPPPS 20 SLAY-screened peptide P502 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATCCCCACCCTATCACTTTTGATTTTCGTCGCCCCCATACTTTGGTCCCTCCGCCTTCGTAA HPHPITFDFRRPHTLVPPPS* -2.729 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22153 TPVYTYNLISTWPARETVYL 20 SLAY-screened peptide P503 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTCCCGTTTATACGTACAATCTCATTTCCACCTGGCCGGCGCGCGAGACTGTCTACTTGTAA TPVYTYNLISTWPARETVYL* -2.727 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22154 QVTHGLPMAII 11 SLAY-screened peptide P504 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGGTCACTCATGGGTTGCCTATGGCCATTATTTAGTTGCATCCTGCCGACGGTGCTGTCTAA QVTHGLPMAII*LHPADGAV* -2.727 0.000003 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22155 PLVLDITWEYALARHNNNLL 20 SLAY-screened peptide P505 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGTTGGTCCTGGACATTACTTGGGAGTACGCTTTGGCCCGTCACAACAATAATTTGCTTTAA PLVLDITWEYALARHNNNLL* -2.72 0.000017 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22156 LRRGDSHFSLVNFYNNTAYY 20 SLAY-screened peptide P506 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCCGCAGGGGCGACAGCCATTTCAGCCTTGTCAATTTCTATAATAATACGGCTTACTATTAA LRRGDSHFSLVNFYNNTAYY* -2.715 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22157 ILCRHVFPRPCDTTYSSDRD 20 SLAY-screened peptide P507 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTTTGTGCCGCCACGTTTTTCCTCGGCCCTGCGACACCACTTATAGTTCTGATAGGGATTAA ILCRHVFPRPCDTTYSSDRD* -2.715 0.00001 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22158 RIC 3 SLAY-screened peptide P508 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGATTTGTTAGCTGCCCGTTAACTATAACGAGCGGACCGATGTCCCGAAGGTCGCTTCCTAA RIC*LPVNYNERTDVPKVAS* -2.712 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22159 CRHLPGVELVKISL 14 SLAY-screened peptide P509 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCCGCCACCTTCCTGGCGTGGAGCTTGTTAAGATTTCTTTGTAGTTCAGTACTTATGCGTAA CRHLPGVELVKISL*FSTYA* -2.712 0.000057 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22160 HRLGTLRSALLLFCIYVLVR 20 SLAY-screened peptide P510 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATCGCTTGGGCACTCTGCGTTCTGCGCTTCTTCTTTTCTGCATCTATGTCCTTGTTCGTTAA HRLGTLRSALLLFCIYVLVR* -2.711 0.000002 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22161 PG 2 SLAY-screened peptide P511 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGGGGTAGTACAGCTAATCCCCTGTGCCTATGTGAGTTTCACGAAGCGTTTTCATGCCTAAC PG*YS*SPVPM*VSRSVFMPN -2.711 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22162 FNPSLNWTNFVRPVTMVSQT 20 SLAY-screened peptide P512 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTTAACCCGTCGCTTAACTGGACTAATTTTGTGCGGCCTGTTACCATGGTTAGCCAGACCTAA FNPSLNWTNFVRPVTMVSQT* -2.71 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22163 RPMRLKAYQPHHPPHYRWIE 20 SLAY-screened peptide P513 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGCCCCATGCGCCTCAAGGCTTATCAGCCTCATCATCCTCCGCATTATCGTTGGATTGAGTAA RPMRLKAYQPHHPPHYRWIE* -2.708 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22164 YHDCAPPQLSLGDLYTLIAS 20 SLAY-screened peptide P514 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATCACGACTGTGCTCCTCCCCAGTTGAGTCTTGGTGATCTTTATACGCTTATCGCGTCCTAA YHDCAPPQLSLGDLYTLIAS* -2.706 0.000007 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22165 NPSLRIYYDNSSCRYKPWLN 20 SLAY-screened peptide P515 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAATCCTTCTCTTCGTATCTATTACGACAATAGTAGTTGTCGCTATAAGCCCTGGCTCAACTAA NPSLRIYYDNSSCRYKPWLN* -2.703 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22166 VFFWSLVLVRRLSKRQP 17 SLAY-screened peptide P516 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTCTTTTTTTGGTCGCTGGTCCTTGTTAGGAGGCTTTCGAAGCGTCAGCCCTAGACTCCCTAA VFFWSLVLVRRLSKRQP*TP* -2.702 0.03098 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22167 GASHLRAYPYIRNVTSFTLY 20 SLAY-screened peptide P517 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGGGCGTCTCATCTCCGTGCTTATCCTTATATTCGGAATGTCACGTCTTTTACTCTTTATTAA GASHLRAYPYIRNVTSFTLY* -2.699 0.000006 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22168 STLLTRNLYDYRWQCCAWSI 20 SLAY-screened peptide P518 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGCACTCTGCTTACTAGGAATTTGTATGACTATCGTTGGCAGTGTTGCGCTTGGTCTATTTAA STLLTRNLYDYRWQCCAWSI* -2.697 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22169 TGLSNDHGDYYSQSKCGEVGY 21 SLAY-screened peptide P519 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCGGTTTGTCCAATGACCATGGGGACTACTACTCTCAGTCTAAGTGTGGGGAGGTGGGCTAC TGLSNDHGDYYSQSKCGEVGY -2.697 0.000036 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22170 NDKSNSYPSFDLFCDSVALP 20 SLAY-screened peptide P520 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACGATAAGAGCAATTCCTACCCTAGTTTTGACTTGTTTTGCGATTCCGTGGCGCTCCCCTAA NDKSNSYPSFDLFCDSVALP* -2.694 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22171 DCLYLYALPASLHCYLIRHA 20 SLAY-screened peptide P521 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGACTGCCTGTACCTTTACGCGCTCCCTGCTTCGTTGCACTGTTACCTTATTCGTCACGCCTAA DCLYLYALPASLHCYLIRHA* -2.694 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22172 YRFNLGFLYVNDQLCTRTDR 20 SLAY-screened peptide P522 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATCGCTTTAATCTCGGCTTCCTTTATGTCAACGATCAGCTTTGTACTCGTACTGACCGCTAA YRFNLGFLYVNDQLCTRTDR* -2.694 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22173 ILRYHRCTDHKQRRHGRRPI 20 SLAY-screened peptide P523 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATCCTTCGGTATCATCGTTGTACTGATCATAAGCAGCGGCGTCATGGGAGGCGTCCCATTTAA ILRYHRCTDHKQRRHGRRPI* -2.693 0.000014 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22174 TLNATVNSCSVNCL 14 SLAY-screened peptide P524 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGCTCAACGCCACTGTTAATAGTTGTAGTGTCAATTGTCTCTAGGCCGCTCTGCGTACGTAA TLNATVNSCSVNCL*AALRT* -2.693 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22175 AAGRSITYSWAVLRLCPHWF 20 SLAY-screened peptide P525 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTGCCGGTCGCAGCATCACCTACAGTTGGGCTGTGCTCAGGCTTTGCCCCCACTGGTTCTAA AAGRSITYSWAVLRLCPHWF* -2.692 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22176 LTSLFLKDSPYNSSNAPELT 20 SLAY-screened peptide P526 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTACTAGCCTGTTCCTCAAGGACAGCCCTTATAATAGTTCTAATGCGCCTGAGTTGACCTAA LTSLFLKDSPYNSSNAPELT* -2.69 0.000034 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22177 YTT 3 SLAY-screened peptide P527 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATATACTACTTAGATGCGTACCACGTCGATTTACAATAATTGCTTTACCGCTCTTGTGCCCTAA YTT*MRTTSIYNNCFTALVP* -2.689 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22178 PPGVLAHVHLGLASSART 18 SLAY-screened peptide P528 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGCCCGGGGTGCTGGCCCATGTGCATCTGGGCCTCGCCTCGTCCGCTAGGACCTAGCAGTAA PPGVLAHVHLGLASSART*Q* -2.689 0.000003 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22179 SSKQFQ 6 SLAY-screened peptide P529 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCGTCTAAGCAGTTCCAGTAGGACTCGTGCCCGAGCGGCCCCCAGCACACCTTGACGGCTTAA SSKQFQ*DSCPSGPQHTLTA* -2.689 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22180 TLG 3 SLAY-screened peptide P530 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGCTGGGGTAGGAGAGGTGGGCGACGGGCCAGCTCGCTCCCAACTCCAGGGACAACGTGTAA TLG*ERWATGQLAPNSRDNV* -2.686 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22181 SHRVLAPTAQLKFTLCYPGA 20 SLAY-screened peptide P531 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCTCATCGCGTCTTGGCGCCGACCGCCCAGCTCAAGTTCACTCTGTGTTACCCTGGTGCCTAA SHRVLAPTAQLKFTLCYPGA* -2.684 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22182 NTPGRPKPTHYMCSLLPAIA 20 SLAY-screened peptide P532 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACACTCCTGGCCGGCCGAAGCCTACCCATTATATGTGTAGTTTGCTTCCGGCTATCGCTTAA NTPGRPKPTHYMCSLLPAIA* -2.681 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22183 NRMVVTINKTTTHHV 15 SLAY-screened peptide P533 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACCGTATGGTTGTGACGATCAACAAGACGACTACTCATCACGTCTAGGACGGTCTTTATTAA NRMVVTINKTTTHHV*DGLY* -2.68 0.000028 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22184 LSAAPRVRVATDYNGSLPNP 20 SLAY-screened peptide P534 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTTCCGCTGCTCCGAGGGTCCGTGTGGCGACTGATTATAACGGTAGCCTTCCCAACCCCTAA LSAAPRVRVATDYNGSLPNP* -2.68 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22185 GRYSHQMRPTSYSANSLI 18 SLAY-screened peptide P535 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGGTCGCTATTCCCACCAGATGCGGCCTACTTCTTATTCGGCTAATTCGCTCATCTAGGGCTAA GRYSHQMRPTSYSANSLI*G* -2.679 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22186 TVSKDDALSLDPSSILKEMP 20 SLAY-screened peptide P536 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGGTGTCTAAGGACGATGCTCTTTCGCTGGATCCTAGTAGCATTCTTAAGGAGATGCCCTAA TVSKDDALSLDPSSILKEMP* -2.679 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22187 PIHDYVRLSFISSCCTCAFN 20 SLAY-screened peptide P537 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCATCCACGACTATGTGCGTCTTAGTTTCATCAGTAGTTGTTGCACTTGTGCGTTTAATTAA PIHDYVRLSFISSCCTCAFN* -2.676 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22188 LRPTSYSG 8 SLAY-screened peptide P538 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCAGGCCCACTAGCTACAGCGGCTAGTTTTACAATTATTATACGCTCTCGAAGTATCTGTAA LRPTSYSG*FYNYYTLSKYL* -2.676 0.000314 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22189 TRLNRPTYTHTSRDTDFDFL 20 SLAY-screened peptide P539 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTCGGCTTAACCGTCCGACGTACACGCACACTTCGCGCGACACTGACTTTGATTTCCTTTAA TRLNRPTYTHTSRDTDFDFL* -2.674 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22190 QCHPLWLWHARDPPSPCRKQ 20 SLAY-screened peptide P540 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGTGCCATCCTTTGTGGCTTTGGCACGCGCGGGACCCGCCGTCTCCGTGCAGGAAGCAGTAA QCHPLWLWHARDPPSPCRKQ* -2.666 0.000003 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22191 TD 2 SLAY-screened peptide P541 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGGATTAGAACTACGGTTCGGCGTATGGCTATTCTCCGAGTTTTATGAATTGTGAGTCGTAA TD*NYGSAYGYSPSFMNCES* -2.666 0.000104 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22192 ARSPVTKAIHSRANYNVFPN 20 SLAY-screened peptide P542 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTCGTAGCCCTGTTACCAAGGCCATTCATTCTCGTGCTAATTATAATGTGTTCCCGAACTAA ARSPVTKAIHSRANYNVFPN* -2.659 0.000015 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22193 APYTH 5 SLAY-screened peptide P543 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGCCTTATACTCATTAGAATACGGATAACGACTGGAATCCGAGTATCAAGCAGAGTCCGTAA APYTH*NTDNDWNPSIKQSP* -2.656 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22194 PTDSTVHVGDIGLFYENTSF 20 SLAY-screened peptide P544 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCACTGACTCTACTGTCCACGTCGGTGACATTGGTTTGTTTTATGAGAATACTAGCTTCTAA PTDSTVHVGDIGLFYENTSF* -2.654 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22195 RTHFTSGFGRHCNIVCTFHF 20 SLAY-screened peptide P545 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGGACGCATTTCACGTCGGGCTTTGGCAGGCACTGCAATATCGTCTGCACCTTCCACTTCTAA RTHFTSGFGRHCNIVCTFHF* -2.653 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22196 TTYCLRSPNAPSPNIH 16 SLAY-screened peptide P546 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGACGTATTGCCTCCGGTCTCCGAATGCTCCTTCGCCGAATATTCATTAGCATCGCCTTTAA TTYCLRSPNAPSPNIH*HRL* -2.653 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22197 LSRNFIIRKGLNVRPQILLC 20 SLAY-screened peptide P547 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTGTCTCGCAATTTCATTATCCGCAAGGGCCTTAACGTGCGTCCTCAGATCCTTCTCTGCTAA LSRNFIIRKGLNVRPQILLC* -2.652 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22198 PPTEQPSIPTARASPTPQDS 20 SLAY-screened peptide P548 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTCCCACTGAGCAGCCTTCTATCCCCACCGCCCGTGCTTCCCCGACGCCGCAGGATAGCTAA PPTEQPSIPTARASPTPQDS* -2.651 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22199 LHNADHRAADHRTISRHK 18 SLAY-screened peptide P549 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCCACAACGCCGATCACCGCGCGGCTGATCATCGCACTATTAGTCGTCACAAGTAATGAGTA LHNADHRAADHRTISRHK**V -2.647 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22200 FKTCFYRDPTIACSHHCDTD 20 SLAY-screened peptide P550 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTCAAGACTTGTTTTTATCGTGACCCTACGATTGCGTGTTCTCACCATTGTGACACCGACTAA FKTCFYRDPTIACSHHCDTD* -2.646 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22201 VLLNRYFKEIGILSRFGTSL 20 SLAY-screened peptide P551 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTGCTCCTCAACCGCTATTTCAAGGAGATCGGTATCCTTAGTCGTTTCGGTACGAGTCTGTAA VLLNRYFKEIGILSRFGTSL* -2.642 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22202 ATLCSNTIGVHD 12 SLAY-screened peptide P552 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCACTCTCTGCTCTAACACGATCGGGGTTCATGATTAGAATATGTACTAGCATATCTATTAA ATLCSNTIGVHD*NMY*HIY* -2.642 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22203 DTTLPSSNGVESPNRNIAIS 20 SLAY-screened peptide P553 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGATACTACCCTCCCTTCGTCTAACGGGGTTGAGAGTCCTAATCGCAATATTGCTATTAGCTAA DTTLPSSNGVESPNRNIAIS* -2.641 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22204 ESDHSPSHLVLHSTHYLTHF 20 SLAY-screened peptide P554 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGAGAGTGATCATTCGCCTTCTCATCTTGTTCTTCATTCTACGCACTACCTGACGCATTTCTAA ESDHSPSHLVLHSTHYLTHF* -2.64 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22205 RSCHAQHCYWYYTLLRASIP 20 SLAY-screened peptide P555 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGGTCCTGCCATGCTCAGCATTGTTATTGGTATTATACTTTGCTGCGTGCCTCCATTCCTTAA RSCHAQHCYWYYTLLRASIP* -2.638 0.000006 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22206 WGGHSMLCLLLAPRGAFAAV 20 SLAY-screened peptide P556 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGGGGTGGCCATAGTATGCTCTGTCTTCTTCTCGCCCCTCGCGGTGCGTTTGCTGCTGTCTAA WGGHSMLCLLLAPRGAFAAV* -2.635 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22207 LIHHSHVLTDSCFFHRNGIE 20 SLAY-screened peptide P557 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCATCCATCACTCTCATGTCCTTACTGATAGCTGCTTTTTCCATCGCAATGGTATTGAGTAA LIHHSHVLTDSCFFHRNGIE* -2.635 0.000008 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22208 CLHTPYPQNLCLNRVCNNLS 20 SLAY-screened peptide P558 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGTCTGCATACCCCTTATCCCCAGAATCTTTGCCTCAATCGTGTTTGTAATAATCTTAGCTAA CLHTPYPQNLCLNRVCNNLS* -2.632 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22209 VHIPLHSP 8 SLAY-screened peptide P559 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTCCACATTCCCCTCCACAGCCCCTAGAATTGCATTTACTACTACAGTGGAAGTTTTTTTAAC VHIPLHSP*NCIYYYSGSFFN -2.628 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22210 CEFLDALGHCHSLSGFPGNV 20 SLAY-screened peptide P560 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGTGAGTTCCTGGACGCTCTGGGCCATTGTCACTCGCTCTCGGGCTTTCCCGGTAATGTGTAA CEFLDALGHCHSLSGFPGNV* -2.628 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22211 YDHFPNFNDNYCWPPITCYL 20 SLAY-screened peptide P561 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATACGATCATTTTCCCAATTTCAATGACAACTATTGCTGGCCTCCTATTACTTGCTATCTGTAA YDHFPNFNDNYCWPPITCYL* -2.627 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22212 SASFT 5 SLAY-screened peptide P562 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGTGCTAGTTTTACGTAGATGCTGTCGGTTTGTGTTGAGGCGCGTACGCCCGCTATTAGGTAA SASFT*MLSVCVEARTPAIR* -2.627 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22213 LPSSMPHILFHCWVGLNRSN 20 SLAY-screened peptide P563 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGCCCTCGAGCATGCCTCACATCCTTTTTCATTGTTGGGTTGGCCTTAATAGGAGTAACTAA LPSSMPHILFHCWVGLNRSN* -2.625 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22214 ARWSFLFLLSTAHCPLPNRN 20 SLAY-screened peptide P564 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCCCGGTGGTCGTTCTTGTTTCTGTTGTCCACTGCGCACTGTCCCTTGCCGAATCGGAATTAA ARWSFLFLLSTAHCPLPNRN* -2.624 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22215 LPPY 4 SLAY-screened peptide P565 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTCCCCCTTATTAGGTTCTTTACCATTTCCATGCTCCTCGGGAGATTGAGAAGATGATCTAA LPPY*VLYHFHAPREIEKMI* -2.623 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22216 LYVRAAYPNLSWSVPVLRVP 20 SLAY-screened peptide P566 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGTACGTCCGCGCTGCCTATCCGAATTTGTCCTGGTCTGTGCCTGTTCTTCGCGTTCCGTAA LYVRAAYPNLSWSVPVLRVP* -2.617 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22217 PCTRSTLSPPNFVVELVSNW 20 SLAY-screened peptide P567 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCTGTACTCGCTCGACCCTTAGTCCGCCCAATTTTGTGGTTGAGCTTGTTAGTAATTGGTAA PCTRSTLSPPNFVVELVSNW* -2.617 0.000023 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22218 PDGFLRRSIPVNPSQTHFAH 20 SLAY-screened peptide P568 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTGACGGTTTTCTTAGGCGTAGTATCCCTGTGAACCCGTCCCAGACGCATTTCGCTCATTAA PDGFLRRSIPVNPSQTHFAH* -2.617 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22219 PKRRRHFSNQLLRAVGKFDD 20 SLAY-screened peptide P569 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCGAAGCGCCGTCGTCATTTTAGCAATCAGCTTCTTCGCGCGGTGGGCAAGTTCGATGACTAA PKRRRHFSNQLLRAVGKFDD* -2.616 0.000007 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22220 DNNNHLK 7 SLAY-screened peptide P570 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGACAATAACAATCATCTTAAGTAGCTGTACTTGAACAAGGGTACGTTCTCCGCCGGCATCTAC DNNNHLK*LYLNKGTFSAGIY -2.616 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22221 LAVVASSCYTIHSHTNPPVT 20 SLAY-screened peptide P571 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTGGCCGTTGTGGCTAGCAGCTGCTATACGATCCATTCCCATACTAATCCCCCTGTTACTTAA LAVVASSCYTIHSHTNPPVT* -2.612 0.000008 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22222 LHFSRLRRL 9 SLAY-screened peptide P572 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCCACTTCTCTAGATTAAGGCGCTTATGACCATGTCCAATACCTACTGCGGGTTGTCCTAAC LHFSRLRRL*PCPIPTAGCPN -2.605 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22223 VTSEPCASAPRGPHPLADSS 20 SLAY-screened peptide P573 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTGACCAGCGAGCCGTGCGCCTCTGCGCCGCGGGGCCCGCACCCTCTCGCGGACTCCAGCTAA VTSEPCASAPRGPHPLADSS* -2.603 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22224 TARNPGPLLSHALCFLANTV 20 SLAY-screened peptide P574 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACTGCGCGGAACCCCGGTCCGCTGCTTTCTCACGCTTTGTGCTTTCTGGCCAATACCGTCTAA TARNPGPLLSHALCFLANTV* -2.603 0.000007 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22225 QLRRENTETILSSIRILPLAN 21 SLAY-screened peptide P575 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACAGCTCCGGCGTGAGAATACTGAGACCATCTTGTCCTCTATACGAATATTGCCCCTTGCTAAC QLRRENTETILSSIRILPLAN -2.602 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22226 VNFNPCPHSNISRPT 15 SLAY-screened peptide P576 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGTTAATTTTAATCCCTGTCCTCATTCGAATATTTCGCGCCCTACTTAGTGCTGCATTCCCTAA VNFNPCPHSNISRPT*CCIP* -2.602 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22227 SLSVPHLRHMLLATTTLALR 20 SLAY-screened peptide P577 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGCTTGTCTGTGCCTCACCTCCGGCATATGCTGCTCGCTACCACCACCCTCGCTCTGCGCTAA SLSVPHLRHMLLATTTLALR* -2.601 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22228 FYGVLIYLRYLFFSFAIFVF 20 SLAY-screened peptide P578 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTCTATGGTGTGCTTATCTACCTGCGCTACCTCTTCTTTTCCTTCGCGATCTTCGTTTTTTAA FYGVLIYLRYLFFSFAIFVF* -2.598 0.000004 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22229 TGPLRHFVNYYNIAHDQTTT 20 SLAY-screened peptide P579 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCGGCCCGCTCCGGCACTTCGTTAATTACTACAATATCGCTCATGATCAGACTACCACTTAA TGPLRHFVNYYNIAHDQTTT* -2.597 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22230 RRTRTPRGDAKNSAYSLGAP 20 SLAY-screened peptide P580 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGTAGGACTCGGACCCCGCGGGGTGATGCCAAGAATTCTGCTTATTCTCTGGGTGCTCCCTAA RRTRTPRGDAKNSAYSLGAP* -2.595 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22231 DLRQDLSGLRIFTISTADLCN 21 SLAY-screened peptide P581 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGACCTTCGGCAGGACCTCTCCGGTCTTCGCATTTTTACTATTAGCACTGCGGACTTATGTAAC DLRQDLSGLRIFTISTADLCN -2.594 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22232 LHHMADNNQVGDTLAEMLVS 20 SLAY-screened peptide P582 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGCATCACATGGCCGACAACAATCAGGTGGGCGACACTCTTGCTGAGATGCTCGTGAGTTAA LHHMADNNQVGDTLAEMLVS* -2.594 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22233 HNHCHTLYNTPTILRPCACT 20 SLAY-screened peptide P583 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACACAATCACTGTCACACTCTGTATAATACTCCCACCATCTTGAGGCCGTGTGCCTGTACTTAA HNHCHTLYNTPTILRPCACT* -2.593 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22234 TFLSPLAGPLCNSSYFLASV 20 SLAY-screened peptide P584 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACGTTTCTGTCCCCTCTCGCCGGGCCCCTCTGCAACTCGTCCTATTTCCTGGCTTCTGTCTAA TFLSPLAGPLCNSSYFLASV* -2.593 0.000003 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22235 SSIRTSVMDLVNYSTNFRNA 20 SLAY-screened peptide P585 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCGAGTATCCGGACCAGTGTTATGGACCTTGTTAATTACTCGACTAACTTTCGTAATGCTTAA SSIRTSVMDLVNYSTNFRNA* -2.592 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22236 LFPAQPAGCHFISPLLPVPAN 21 SLAY-screened peptide P586 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCTTTCCTGCTCAGCCTGCTGGCTGCCATTTCATCAGTCCATTATTACCAGTCCCCGCTAAC LFPAQPAGCHFISPLLPVPAN -2.592 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22237 AVARWLRDLNAVDIADFSRS 20 SLAY-screened peptide P587 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCTGTGGCTCGTTGGCTTCGTGACCTCAACGCTGTTGATATTGCTGACTTCTCTAGGAGCTAA AVARWLRDLNAVDIADFSRS* -2.591 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22238 CLHTTLYTWILGSTFCGFLC 20 SLAY-screened peptide P588 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATGCCTGCACACTACCCTCTATACTTGGATTCTGGGTTCGACTTTCTGCGGTTTCCTTTGCTAA CLHTTLYTWILGSTFCGFLC* -2.591 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22239 HLHRRCRQSFFYPRLAPNRM 20 SLAY-screened peptide P589 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATTTGCATCGGAGGTGCCGGCAGTCTTTTTTTTATCCTCGTTTGGCTCCCAATCGGATGTAA HLHRRCRQSFFYPRLAPNRM* -2.588 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22240 PTYLALATQHPNDNLGHDRR 20 SLAY-screened peptide P590 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCACCTATTTGGCGTTGGCCACTCAGCACCCTAACGACAACCTGGGTCACGATCGTAGGTAA PTYLALATQHPNDNLGHDRR* -2.588 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22241 SVLFRVTTHTHHNKT 15 SLAY-screened peptide P591 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCGTCCTTTTTCGTGTCACTACGCATACGCACCATAACAAGACCTAGGGGTAGCCGACCTAA SVLFRVTTHTHHNKT*G*PT* -2.587 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22242 LDSTHHYNKYMYASPL 16 SLAY-screened peptide P592 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTGATAGTACGCACCATTATAATAAGTATATGTATGCTTCTCCCTTGTAGTCTAACAATTAA LDSTHHYNKYMYASPL*SNN* -2.586 0.000076 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22243 TPLNYSVRNPHFTIDVPYTS 20 SLAY-screened peptide P593 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCCCGCTTAACTACTCGGTCCGCAATCCTCATTTTACTATTGACGTTCCCTATACTTCTTAA TPLNYSVRNPHFTIDVPYTS* -2.585 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22244 IIFCAMRPTSHIEPVTTSGN 20 SLAY-screened peptide P594 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTATTTTTTGCGCTATGCGGCCTACTTCTCATATCGAGCCCGTGACTACCTCGGGCAACTAA IIFCAMRPTSHIEPVTTSGN* -2.582 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22245 ASPPVMSSKTPSCVSNITNY 20 SLAY-screened peptide P595 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAGCGTCGCCCCCCGTGATGTCCAGCAAGACTCCTTCTTGTGTCTCTAACATCACTAACTATTAA ASPPVMSSKTPSCVSNITNY* -2.581 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22246 RIVNMSRPPYRIKFSVHSCD 20 SLAY-screened peptide P596 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGTATCGTCAATATGTCCCGGCCTCCTTACCGTATTAAGTTTTCTGTGCACTCGTGTGATTAA RIVNMSRPPYRIKFSVHSCD* -2.581 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22247 INLVCI 6 SLAY-screened peptide P597 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAATTAACCTTGTGTGCATTTAGCTTCTCACCGCTGCGCACATTTATTATGTTCGGACGTTTTAA INLVCI*LLTAAHIYYVRTF* -2.579 0.000087 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22248 PSRSMHHYPSRAVLMPLLRVN 21 SLAY-screened peptide P598 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCAGTCGGTCTATGCATCACTATCCGTCTCGCGCCGTGTTGATGCCGCTGCTGCGAGTTAAC PSRSMHHYPSRAVLMPLLRVN -2.578 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22249 HRKFTSNHLNYCITNKARLLN 21 SLAY-screened peptide P599 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACATCGGAAGTTCACGTCTAATCATCTTAACTATTGCATTACGAATAAAGCTCGCTTGCTTAAC HRKFTSNHLNYCITNKARLLN -2.577 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22250 RTSIHLFT 8 SLAY-screened peptide P600 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACGTACTTCGATCCATCTGTTTACCTAGATGTTTAGCAGTGGTTTGGCTTCACTGTGTATTAAC RTSIHLFT*MFSSGLASLCIN -2.576 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22251 SAPYTLVPLSYLNCNLPTDL 20 SLAY-screened peptide P601 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAGCGCCCCTTACACCCTGGTCCCGCTTTCGTATCTTAATTGCAATCTGCCTACTGACTTGTAA SAPYTLVPLSYLNCNLPTDL* -2.575 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22252 TPVYPLSDL 9 SLAY-screened peptide P602 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAACCCCTGTTTACCCTTTGTCTGATCTTTAGCCCTTCATGCGCCCCTCGCGCATGAGGTGTTAA TPVYPLSDL*PFMRPSRMRC* -2.571 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22253 LILCVLGCPCFVL 13 SLAY-screened peptide P603 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATTGATCCTTTGTGTCCTGGGCTGTCCTTGTTTTGTCCTTTAGTCTACATTTTGAGGCCGTAAC LILCVLGCPCFVL*STF*GRN -2.57 0.000586 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22254 PNVCDALPPSRACTLSAPSR 20 SLAY-screened peptide P604 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCAATGTCTGTGATGCCCTTCCTCCTTCGCGCGCGTGTACCCTGAGCGCCCCCTCTCGGTAA PNVCDALPPSRACTLSAPSR* -2.57 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22255 PPSVLIDGYFRPSDCSSERTN 21 SLAY-screened peptide P605 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCTCCTTCTGTCCTTATTGACGGCTACTTCAGGCCTTCTGACTGTAGTTCCGAGAGGACTAAC PPSVLIDGYFRPSDCSSERTN -2.57 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22256 PH 2 SLAY-screened peptide P606 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCCACTAGCGTTGGCGGCTTCTCTTCCACTATTAGGCCCCCCTTTTGTGCATCCGTTGCTAA PH*RWRLLFHY*APLLCIRC* -2.569 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22257 LSYHLNYPVNCSDHLHGLPC 20 SLAY-screened peptide P607 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTCTCCTATCATCTCAATTATCCCGTTAATTGTAGTGACCACCTGCACGGTTTGCCCTGTTAA LSYHLNYPVNCSDHLHGLPC* -2.567 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22258 PNGTLIFCPLHSPRFLA 17 SLAY-screened peptide P608 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCAATGGGACTCTTATCTTCTGTCCTCTGCATTCTCCTCGCTTTCTCGCTTAGGTGTGTTAA PNGTLIFCPLHSPRFLA*VC* -2.563 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22259 LAAP 4 SLAY-screened peptide P609 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTTGCTGCCCCTTAGTTTTCTTCTCTTGGTTCCGTGCTTATCCCGACGATCAGCTACAGCTAA LAAP*FSSLGSVLIPTISYS* -2.563 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22260 NLSLNSQGMARHRTDRATLS 20 SLAY-screened peptide P610 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACCTGTCGCTCAATTCGCAGGGCATGGCGAGGCACCGCACGGATCGTGCTACTCTGTCGTAA NLSLNSQGMARHRTDRATLS* -2.563 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22261 PRSYNLGTVPPRSDPYNILN 20 SLAY-screened peptide P611 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCCGTTCCTACAATCTGGGTACGGTGCCTCCGCGTTCTGATCCCTACAATATTCTTAATTAA PRSYNLGTVPPRSDPYNILN* -2.56 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22262 LRLRSLCLFCTVFSNNDSHA 20 SLAY-screened peptide P612 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACTGCGCCTTCGTTCTCTTTGTTTGTTTTGCACGGTTTTCTCCAATAACGATTCCCACGCGTAA LRLRSLCLFCTVFSNNDSHA* -2.559 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22263 NFHSRSPTNLAKTNKNPVME 20 SLAY-screened peptide P613 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGAAACTTTCATAGTCGTTCGCCGACTAATCTTGCTAAGACTAATAAGAATCCTGTCATGGAGTAA NFHSRSPTNLAKTNKNPVME* -2.557 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22264 SATNIRSHYLNFMVSILCMT 20 SLAY-screened peptide P614 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCGCGACGAATATTAGGAGTCACTATCTCAACTTTATGGTTAGTATTCTGTGCATGACTTAA SATNIRSHYLNFMVSILCMT* -2.556 0.000049 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22265 PAQVASFILRVFRHIREHMH 20 SLAY-screened peptide P615 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCGCTCAGGTCGCCAGTTTCATCTTGCGCGTCTTTCGGCATATCCGGGAGCATATGCACTAA PAQVASFILRVFRHIREHMH* -2.553 0.000008 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22266 SLTFKFNRLYFTLRAWGTFG 20 SLAY-screened peptide P616 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGATCCCTTACCTTCAAGTTCAATCGGCTGTATTTCACTCTGAGGGCCTGGGGCACCTTTGGCTAA SLTFKFNRLYFTLRAWGTFG* -2.553 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22267 PVQPNHCTRHASD 13 SLAY-screened peptide P617 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries Candidate AMP GGAGGACCCGTTCAGCCTAATCATTGCACTCGTCACGCTTCGGATTAGGCCACCCTTACCTATTACTAA PVQPNHCTRHASD*ATLTYY* -2.548 0 "Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively." DRAMP22268 TRVPSFLRLFILRFRSRRILN 21 SLAY-screened peptide P618 Screening and prediction of SLAY Putatively-antimicrobial Linear 29307492 Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. "Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies" Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of S