Please note that the entry you are browsing is obtained from a High-Throughput Screening method, and its antibacterial activity requires further experimental validation.
General Information
-
DRAMP ID
- DRAMP21909
-
Peptide Name
- SLAY-screened peptide P259
-
Sequence
- TSVDPNICICILFGHLSGYY
-
Sequence Length
- 20
-
Nucleotide Sequence
- GGAGGAACTTCCGTGGATCCTAACATTTGTATCTGTATCCTTTTTGGTCATCTCAGTGGTTACTATTAA
-
Source
- Screening by SLAY
-
Linear/Cyclic
- Linear
-
Biological Activity
- Anti-recombinant genetically engineered E. coli
-
Screening/Prediction Workflow
- Batch screening of peptides using SLAY system can be achieved by first constructing a random library using random PCR primers that flank the peptide region (i), followed by collection of transformants, plasmid isolation, and subsequent transformation into a bacterial strain of interest. Next, the library is grown in culture and induced (ii). Peptides with antimicrobial activity (red) will drop out of the population (iii). Next-generation sequencing of the initial input at time zero and output (iv) at a pre-defined number of hours provides a read out of sequencing counts (v). From this information, top hits can be identified and tested. Further libraries can be constructed based on the identified top hits and the process can be repeated. Log2 fold values indicate the degree to which the peptides were removed from the population. If the remaining antimicrobial peptides after sequencing show a log2 fold change of -1 or lower, indicating they were removed from the population over the time course. lfcMLE and Padj represent log2 FoldChange MLE and p values adjusted, respectively.
- lfcMLE: -3.443 Padj: 0
-
Helical Wheel Diagram
Physicochemical Information
-
Formula
- C101H151N23O29S2
Absent Amino Acids
- AEKMQRW
Common Amino Acids
- I
Mass
- 2215.57
PI
- 5.05
Basic Residues
- 1
Acidic Residues
- 1
Charge
- -1.036
Charge of Full Sequence
- -1.036
-
Boman Index
- 639
Hydrophobic Residues
- 7
Hydrophobicity
- 0.78
Hydrophobicity of Full Sequence
- 0.78
Aliphatic Index
- 112
Half Life
-
- Mammalian:7.2 hour
- Yeast:>20 hour
- E.coli:>10 hour
Extinction Coefficient Cystines
- 3105
Absorbance 280nm
- 163.42
Polar Residues
- 10
DRAMP21909
Literature Information
- Literature 1
-
Title
- Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries
-
Pubmed ID
- 29307492
-
Reference
- Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4.
-
Author
- Ashley T Tucker, Sean P Leonard, Cory D DuBois, Gregory A Knauf, Ashley L Cunningham, Claus O Wilke, M Stephen Trent, Bryan W Davies
